HUGE |
Gene/Protein Characteristic Table for KIAA0814 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK01606 |
---|---|
Accession No. : | AB011538 |
Description : | Slit homolog 3 protein precursor. |
HUGO Gene Name : | |
Clone Name : | fh16048 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0814
![]() |
Source : | Human fetal brain |
Note : | We replaced hg02635, former representative clones for KIAA0814 with fh16048. (1998/8/22) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5156 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 164 bp Genome contig ID gi51511721r_167925873 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
TAAGTATATTGTAAAATAAACAAAAAATAGAACTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATTTTTATTATGGAAAGTGACTATTTTCATCTTTTATTATATAAATATAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 r 168025873 168660711 35 100.0 Internal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 1559 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 5 |
: GeneBridge 4 | |
: TCTAACCTTTCCCTTCACCAG | |
: GTAATGCCCTATGACTCCTCC | |
: 165 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |