HUGE |
Gene/Protein Characteristic Table for KIAA0279 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04527 |
---|---|
Accession No. : | D87469 |
Description : | Cadherin EGF LAG seven-pass G-type receptor 2 precursor. |
HUGO Gene Name : | cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) (CELSR2) |
Clone Name : | ff05612 [Vector Info] |
Source : | Human fetal brain |
Note : | We replaced ha06133, former representative clones for KIAA0279 with ff05612. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 10267 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1702 bp Genome contig ID gi89161185f_109494432 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
CCCCATACTACTGAATAAACTAGTTCTGTGCGGGTFlanking genome sequence
(125465 - 125514) ----+----*----+----*----+----*----+----*----+----*
ACAGCACTGTCACTGTCCGCTTCTGTGTGGTACCCTGTCCTCCCACAGGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 109594432 109619895 34 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2854 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 1 |
: Genebridge 4 | |
: TGCTGGATGCTAACTTGATAC | |
: GTTTATTCAGTAGTATGGGGC | |
: 112 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |