HUGE |
Gene/Protein Characteristic Table for KIAA0812 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK06860 |
---|---|
Accession No. : | AB011536 |
Description : | Solute carrier family 26 member 6. |
HUGO Gene Name : | |
Clone Name : | hg01044 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5832 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1736 bp Genome contig ID gi89161205r_48548906 PolyA signal sequence
(AATAAA,-15) +----*----+----*----+----*----+----
AAGCCGCGCTCTGTTTTGGGAATAAACTTCTATAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAACAGTTGTTGCCTTTTCCTGTTGGGGGCTGGGGAGGTAGGATGGAAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 r 48648906 48664378 24 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1364 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 3 |
: GeneBridge 4 | |
: TCGGTAAGGAGAGTTTGGGTC | |
: CAGACACTCCTCACCCACCAC | |
: 124 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |