HUGE |
Gene/Protein Characteristic Table for KIAA0550 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00559 |
---|---|
Accession No. : | AB011122 |
Description : | Brain-specific angiogenesis inhibitor 3 precursor. |
HUGO Gene Name : | brain-specific angiogenesis inhibitor 3 (BAI3) |
Clone Name : | hh15909 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0550 |
Source : | Human adult brain |
Note : | We replaced hh00851, former representative clones for KIAA0550 with hh15909. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5420 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 614 bp Genome contig ID gi89161210f_69302564 PolyA signal sequence
(AATAAA,-17) +----*----+----*----+----*----+----
AAAATGTTGTATGGTGTAAATAAACTTTTGTCTACFlanking genome sequence
(853556 - 853605) ----+----*----+----*----+----*----+----*----+----*
ATATCAGTTTTTTAGTGCATTTTATTTTGGATTTGTTGACCAGAAATTTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 f 69402564 70156118 32 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1524 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: ATCATTTCACATACCTCCTGC | |
: GGATAAGGATGAGGAGGGGAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 6 |
: GeneBridge 4 | |
: ATCATTTCACATACCTCCTGC | |
: GGATAAGGATGAGGAGGGGAC | |
: 127 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |