HUGE

Gene/Protein Characteristic Table for KIAA1812

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05717
Accession No. :	AB058715
Description :
HUGO Gene Name :
Clone Name :	hh13045 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5974 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3560 bp

Genome contig ID gi89161187f_72975679
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AATATTTTCAAAATAATAACAGATTTCACAAAAAT
Flanking genome sequence
(170964 - 171013)
----+----*----+----*----+----*----+----*----+----*
ATATGGGTGCCTGAATTCTCTTGAAATGTCAGAATTTCACCACTGGCATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 73075679 73146641 17 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 803 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI40838	99.7	cadherin-like 2...	Homo sapiens
EAW54430	98.0	cadherin-like 2...	Homo sapiens
Q9H251	99.9	Cadherin-23; Ot...	Homo sapiens
NP_071407	99.9	cadherin-like 2...	Homo sapiens
CAI13426	99.9	cadherin-like 2...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87469	1.6e-36	35.2	KIAA0279
AB053445	2.6e-36	32.0	KIAA1774
AB053446	7.5e-33	31.4	KIAA1773
AB046782	7.3e-28	28.2	KIAA1562
AB002343	1e-21	30.9	KIAA0345

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002126 51 80 PR00205 Cadherin

IPR002126 119 131 PR00205 Cadherin

IPR002126 241 260 PR00205 Cadherin

IPR002126 260 273 PR00205 Cadherin

IPR002126 534 560 PR00205 Cadherin

IPR002126 675 692 PR00205 Cadherin

HMMPfam IPR002126 56 143 PF00028 Cadherin

IPR002126 157 253 PF00028 Cadherin

IPR002126 267 360 PF00028 Cadherin

IPR002126 374 470 PF00028 Cadherin

IPR002126 486 577 PF00028 Cadherin

IPR002126 591 682 PF00028 Cadherin

HMMSmart IPR002126 73 150 SM00112 Cadherin

IPR002126 174 260 SM00112 Cadherin

IPR002126 284 367 SM00112 Cadherin

IPR002126 391 479 SM00112 Cadherin

IPR002126 503 584 SM00112 Cadherin

IPR002126 608 691 SM00112 Cadherin

ProfileScan IPR002126 4 51 PS50268 Cadherin

IPR002126 52 152 PS50268 Cadherin

IPR002126 153 262 PS50268 Cadherin

IPR002126 263 375 PS50268 Cadherin

IPR002126 370 481 PS50268 Cadherin

IPR002126 482 586 PS50268 Cadherin

IPR002126 587 693 PS50268 Cadherin

ScanRegExp IPR002126 140 150 PS00232 Cadherin

IPR002126 250 260 PS00232 Cadherin

IPR002126 357 367 PS00232 Cadherin

IPR002126 469 479 PS00232 Cadherin

IPR002126 681 691 PS00232 Cadherin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	51	80	PR00205	Cadherin
IPR002126	119	131	PR00205	Cadherin
IPR002126	241	260	PR00205	Cadherin
IPR002126	260	273	PR00205	Cadherin
IPR002126	534	560	PR00205	Cadherin
IPR002126	675	692	PR00205	Cadherin
HMMPfam	IPR002126	56	143	PF00028	Cadherin
IPR002126	157	253	PF00028	Cadherin
IPR002126	267	360	PF00028	Cadherin
IPR002126	374	470	PF00028	Cadherin
IPR002126	486	577	PF00028	Cadherin
IPR002126	591	682	PF00028	Cadherin
HMMSmart	IPR002126	73	150	SM00112	Cadherin
IPR002126	174	260	SM00112	Cadherin
IPR002126	284	367	SM00112	Cadherin
IPR002126	391	479	SM00112	Cadherin
IPR002126	503	584	SM00112	Cadherin
IPR002126	608	691	SM00112	Cadherin
ProfileScan	IPR002126	4	51	PS50268	Cadherin
IPR002126	52	152	PS50268	Cadherin
IPR002126	153	262	PS50268	Cadherin
IPR002126	263	375	PS50268	Cadherin
IPR002126	370	481	PS50268	Cadherin
IPR002126	482	586	PS50268	Cadherin
IPR002126	587	693	PS50268	Cadherin
ScanRegExp	IPR002126	140	150	PS00232	Cadherin
IPR002126	250	260	PS00232	Cadherin
IPR002126	357	367	PS00232	Cadherin
IPR002126	469	479	PS00232	Cadherin
IPR002126	681	691	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTCACCAAAACCACAGATAGC

Primer_r
: CAAGAGGCAGGGCATTTCCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTCACCAAAACCACAGATAGC
Primer_r	: CAAGAGGCAGGGCATTTCCAG
PCR product length	: 95 bp
PCR conditions	: 15 °C64 sec60 °C30 sec194 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3560 bp
Genome contig ID	gi89161187f_72975679
PolyA signal sequence (None)	+--------+--------+----*----+---- AATATTTTCAAAATAATAACAGATTTCACAAAAAT
Flanking genome sequence (170964 - 171013)	----+--------+--------+--------+--------+----* ATATGGGTGCCTGAATTCTCTTGAAATGTCAGAATTTCACCACTGGCATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	73075679	73146641	17	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA1812

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information