HUGE |
Gene/Protein Characteristic Table for KIAA1774 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04514 |
---|---|
Accession No. : | AB053445 |
Description : | Cadherin-23 precursor. |
HUGO Gene Name : | |
Clone Name : | hk10268 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4256 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1078 bp Genome contig ID gi89161187f_73126672 PolyA signal sequence
(None) +----*----+----*----+----*----+----
ATAAACAGAAGTGACTGATGTTCCCTCCGGTTTTGFlanking genome sequence
(118989 - 119038) ----+----*----+----*----+----*----+----*----+----*
AATGTGGAGTGTTTGTGTGTGTTCCTTTTTTAAATTAAGTTATTCCCTCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 f 73226619 73245659 21 99.7 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1041 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CCAAGTCTCGCTACATTTCCG | |
: GTGAAATGGAGAGAATGCTTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 10 |
: GeneBridge 4 | |
: CCAAGTCTCGCTACATTTCCG | |
: GTGAAATGGAGAGAATGCTTG | |
: 115 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |