HUGE |
Gene/Protein Characteristic Table for KIAA1773 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01696 |
---|---|
Accession No. : | AB053446 |
Description : | Protocadherin-16 precursor. |
HUGO Gene Name : | dachsous 1 (Drosophila) (DCHS1) |
Clone Name : | hj00752s2 [Vector Info] |
Flexi ORF Clone : | pF1KA1773
![]() |
Source : | Human adult brain |
Note : | We replaced hj00752x1, former representative clones for KIAA1773 with hj00752s2. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 10759 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 452 bp Genome contig ID gi51511727r_6499134 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
CACTCTGGAGCCTTAATAAACTGCAATTTGTATCCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGTCTCCAGCTTTGTTCTATAGGGATGACTGGAAGACACCTGGCAGAGTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 r 6599134 6633661 21 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 3434 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ACCCTGAGATGGAGCTGAGAC | |
: CAGTTTATTAAGGCTCCAGAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 11 |
: GeneBridge 4 | |
: GCTGTGGAGGATGAGAATGAC | |
: CGAAGCATGGTAAGGGTCTGG | |
: 101 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |