HUGE |
Gene/Protein Characteristic Table for KIAA1775 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK02053 |
---|---|
Accession No. : | AB053448 |
Description : | protocadherin 21 precursor. |
HUGO Gene Name : | protocadherin 21 (PCDH21) |
Clone Name : | hk03826 [Vector Info] |
Flexi ORF Clone : | pF1KA1775 |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4483 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1904 bp Genome contig ID gi89161187f_85844498 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
TTGTAAATGGAAAATAAAGTCTGTTACCCAAAGGCFlanking genome sequence
(121765 - 121814) ----+----*----+----*----+----*----+----*----+----*
CATGCTGATCCCCTGCTCCCTGCTTTCATTTATGTTTGCTGACCTGTGGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 f 85944498 85966261 17 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 858 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TACAGTCCCCAACGTGAACAG | |
: AAGCATGATCCAGCACAGTCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 10 |
: GeneBridge 4 | |
: TACAGTCCCCAACGTGAACAG | |
: AAGCATGATCCAGCACAGTCC | |
: 122 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |