HUGE

Gene/Protein Characteristic Table for KIAA0813

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00644
Accession No. :	AB011537
Description :	Slit homolog 1 protein precursor.
HUGO Gene Name :
Clone Name :	pf00581 [Vector Info]
Flexi ORF Clone :	pF1KSDA0813
Source :	Human brain (hippocampus)
Note :	We replaced hh00849, former representative clones for KIAA0813 with pf00581. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 7931 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3074 bp

Genome contig ID gi89161187r_98647785
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GTCTTCCATGTGAACATGACATTGAGTCACTCTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CTTGTTGGTCTCTTTTTCTCCACCAAGGGCGGGCCGGGTGCTGCTGGCAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 98747785 98935673 37 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1618 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAA32465	100.0	MEGF4 [Homo sap...	Homo sapiens
XP_001094231	96.2	slit homolog 1 ...	Macaca mulatta
AAI46762	100.0	Slit homolog 1 ...	Homo sapiens
O75093	99.9	Slit homolog 1 ...	Homo sapiens
BAA35184	99.8	Slit-1 protein ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011538	2.4e-202	59.0	KIAA0814
D86983	8e-14	35.9	KIAA0230
AB053450	2e-11	22.7	KIAA1776
AB011539	3.6e-10	27.1	KIAA0815
D87469	5.9e-10	24.8	KIAA0279

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 219 232 PR00019 Leucine-rich repeat

IPR001611 648 661 PR00019 Leucine-rich repeat

HMMPfam IPR000372 117 144 PF01462 Leucine-rich repeat

IPR001611 146 168 PF00560 Leucine-rich repeat

IPR001611 170 192 PF00560 Leucine-rich repeat

IPR001611 194 216 PF00560 Leucine-rich repeat

IPR001611 218 240 PF00560 Leucine-rich repeat

IPR001611 242 264 PF00560 Leucine-rich repeat

IPR001611 266 288 PF00560 Leucine-rich repeat

IPR000483 323 348 PF01463 Cysteine-rich flanking region

IPR000372 365 392 PF01462 Leucine-rich repeat

IPR001611 418 440 PF00560 Leucine-rich repeat

IPR001611 442 464 PF00560 Leucine-rich repeat

IPR001611 466 488 PF00560 Leucine-rich repeat

IPR001611 490 512 PF00560 Leucine-rich repeat

IPR000483 547 572 PF01463 Cysteine-rich flanking region

IPR000372 596 623 PF01462 Leucine-rich repeat

IPR001611 650 672 PF00560 Leucine-rich repeat

IPR001611 674 696 PF00560 Leucine-rich repeat

IPR001611 698 720 PF00560 Leucine-rich repeat

IPR001611 722 744 PF00560 Leucine-rich repeat

IPR000483 779 804 PF01463 Cysteine-rich flanking region

IPR000372 817 844 PF01462 Leucine-rich repeat

IPR001611 846 867 PF00560 Leucine-rich repeat

IPR001611 869 891 PF00560 Leucine-rich repeat

IPR001611 893 915 PF00560 Leucine-rich repeat

IPR001611 917 939 PF00560 Leucine-rich repeat

IPR000483 974 999 PF01463 Cysteine-rich flanking region

IPR006209 1013 1045 PF00008 EGF-like

IPR006209 1052 1086 PF00008 EGF-like

IPR006209 1093 1124 PF00008 EGF-like

IPR006209 1131 1164 PF00008 EGF-like

IPR006209 1171 1202 PF00008 EGF-like

IPR006209 1215 1246 PF00008 EGF-like

IPR012680 1278 1406 PF02210 Laminin G

IPR006209 1426 1457 PF00008 EGF-like

IPR006209 1465 1496 PF00008 EGF-like

IPR006209 1506 1537 PF00008 EGF-like

HMMSmart IPR000372 117 149 SM00013 Leucine-rich repeat

IPR003591 143 167 SM00369 Leucine-rich repeat

IPR003591 168 191 SM00369 Leucine-rich repeat

IPR003591 192 215 SM00369 Leucine-rich repeat

IPR003591 217 239 SM00369 Leucine-rich repeat

NULL 240 261 SM00365 NULL

IPR003591 241 263 SM00369 Leucine-rich repeat

IPR003591 264 287 SM00369 Leucine-rich repeat

IPR000483 299 348 SM00082 Cysteine-rich flanking region

IPR000372 365 397 SM00013 Leucine-rich repeat

IPR003591 391 415 SM00369 Leucine-rich repeat

NULL 416 437 SM00365 NULL

IPR003591 416 439 SM00369 Leucine-rich repeat

IPR003591 440 463 SM00369 Leucine-rich repeat

IPR003591 464 487 SM00369 Leucine-rich repeat

NULL 488 506 SM00365 NULL

IPR003591 488 511 SM00369 Leucine-rich repeat

IPR000483 523 572 SM00082 Cysteine-rich flanking region

IPR000372 596 628 SM00013 Leucine-rich repeat

NULL 648 669 SM00365 NULL

IPR003591 648 671 SM00369 Leucine-rich repeat

IPR003591 673 695 SM00369 Leucine-rich repeat

NULL 696 717 SM00365 NULL

IPR003591 696 719 SM00369 Leucine-rich repeat

NULL 720 741 SM00365 NULL

IPR003591 720 743 SM00369 Leucine-rich repeat

IPR000483 755 804 SM00082 Cysteine-rich flanking region

IPR000372 817 849 SM00013 Leucine-rich repeat

NULL 867 888 SM00365 NULL

IPR003591 867 890 SM00369 Leucine-rich repeat

NULL 891 912 SM00365 NULL

IPR003591 891 914 SM00369 Leucine-rich repeat

IPR003591 915 938 SM00369 Leucine-rich repeat

IPR000483 950 999 SM00082 Cysteine-rich flanking region

IPR001881 1009 1046 SM00179 EGF-like calcium-binding

IPR006210 1012 1046 SM00181 EGF

IPR001881 1048 1087 SM00179 EGF-like calcium-binding

IPR006210 1051 1087 SM00181 EGF

IPR001881 1089 1125 SM00179 EGF-like calcium-binding

IPR003645 1092 1114 SM00274 Follistatin-like

IPR006210 1092 1125 SM00181 EGF

IPR001881 1128 1165 SM00179 EGF-like calcium-binding

IPR006210 1130 1165 SM00181 EGF

IPR001881 1167 1203 SM00179 EGF-like calcium-binding

IPR006210 1170 1203 SM00181 EGF

IPR003645 1170 1192 SM00274 Follistatin-like

IPR006210 1214 1247 SM00181 EGF

IPR003645 1214 1236 SM00274 Follistatin-like

IPR001881 1215 1247 SM00179 EGF-like calcium-binding

IPR001791 1270 1406 SM00282 Laminin G

IPR006210 1425 1458 SM00181 EGF

IPR006210 1464 1497 SM00181 EGF

IPR001881 1465 1497 SM00179 EGF-like calcium-binding

IPR006210 1505 1538 SM00181 EGF

IPR003645 1505 1527 SM00274 Follistatin-like

IPR006207 1549 1618 SM00041 Cystine knot

ProfileScan IPR000742 1011 1046 PS50026 EGF-like

IPR000742 1048 1087 PS50026 EGF-like

IPR000742 1089 1125 PS50026 EGF-like

IPR000742 1127 1165 PS50026 EGF-like

IPR000742 1167 1203 PS50026 EGF-like

IPR000742 1211 1247 PS50026 EGF-like

IPR001791 1250 1423 PS50025 Laminin G

IPR000742 1424 1458 PS50026 EGF-like

IPR000742 1461 1497 PS50026 EGF-like

IPR000742 1502 1538 PS50026 EGF-like

IPR006207 1543 1618 PS01225 Cystine knot

ScanRegExp IPR013032 1034 1045 PS00022 EGF-like region

IPR013032 1034 1045 PS01186 EGF-like region

IPR013032 1075 1086 PS00022 EGF-like region

IPR013032 1075 1086 PS01186 EGF-like region

IPR001881 1089 1113 PS01187 EGF-like calcium-binding

IPR000152 1104 1115 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 1113 1124 PS00022 EGF-like region

IPR013032 1153 1164 PS00022 EGF-like region

IPR013032 1153 1164 PS01186 EGF-like region

IPR001881 1167 1191 PS01187 EGF-like calcium-binding

IPR000152 1182 1193 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 1191 1202 PS00022 EGF-like region

IPR013032 1191 1202 PS01186 EGF-like region

IPR013032 1235 1246 PS00022 EGF-like region

IPR013032 1235 1246 PS01186 EGF-like region

IPR013032 1446 1457 PS00022 EGF-like region

IPR013032 1446 1457 PS01186 EGF-like region

IPR013032 1485 1496 PS00022 EGF-like region

IPR013032 1485 1496 PS01186 EGF-like region

IPR013032 1526 1537 PS00022 EGF-like region

IPR013032 1526 1537 PS01186 EGF-like region

IPR006207 1581 1617 PS01185 Cystine knot

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	219	232	PR00019	Leucine-rich repeat
IPR001611	648	661	PR00019	Leucine-rich repeat
HMMPfam	IPR000372	117	144	PF01462	Leucine-rich repeat
IPR001611	146	168	PF00560	Leucine-rich repeat
IPR001611	170	192	PF00560	Leucine-rich repeat
IPR001611	194	216	PF00560	Leucine-rich repeat
IPR001611	218	240	PF00560	Leucine-rich repeat
IPR001611	242	264	PF00560	Leucine-rich repeat
IPR001611	266	288	PF00560	Leucine-rich repeat
IPR000483	323	348	PF01463	Cysteine-rich flanking region
IPR000372	365	392	PF01462	Leucine-rich repeat
IPR001611	418	440	PF00560	Leucine-rich repeat
IPR001611	442	464	PF00560	Leucine-rich repeat
IPR001611	466	488	PF00560	Leucine-rich repeat
IPR001611	490	512	PF00560	Leucine-rich repeat
IPR000483	547	572	PF01463	Cysteine-rich flanking region
IPR000372	596	623	PF01462	Leucine-rich repeat
IPR001611	650	672	PF00560	Leucine-rich repeat
IPR001611	674	696	PF00560	Leucine-rich repeat
IPR001611	698	720	PF00560	Leucine-rich repeat
IPR001611	722	744	PF00560	Leucine-rich repeat
IPR000483	779	804	PF01463	Cysteine-rich flanking region
IPR000372	817	844	PF01462	Leucine-rich repeat
IPR001611	846	867	PF00560	Leucine-rich repeat
IPR001611	869	891	PF00560	Leucine-rich repeat
IPR001611	893	915	PF00560	Leucine-rich repeat
IPR001611	917	939	PF00560	Leucine-rich repeat
IPR000483	974	999	PF01463	Cysteine-rich flanking region
IPR006209	1013	1045	PF00008	EGF-like
IPR006209	1052	1086	PF00008	EGF-like
IPR006209	1093	1124	PF00008	EGF-like
IPR006209	1131	1164	PF00008	EGF-like
IPR006209	1171	1202	PF00008	EGF-like
IPR006209	1215	1246	PF00008	EGF-like
IPR012680	1278	1406	PF02210	Laminin G
IPR006209	1426	1457	PF00008	EGF-like
IPR006209	1465	1496	PF00008	EGF-like
IPR006209	1506	1537	PF00008	EGF-like
HMMSmart	IPR000372	117	149	SM00013	Leucine-rich repeat
IPR003591	143	167	SM00369	Leucine-rich repeat
IPR003591	168	191	SM00369	Leucine-rich repeat
IPR003591	192	215	SM00369	Leucine-rich repeat
IPR003591	217	239	SM00369	Leucine-rich repeat
NULL	240	261	SM00365	NULL
IPR003591	241	263	SM00369	Leucine-rich repeat
IPR003591	264	287	SM00369	Leucine-rich repeat
IPR000483	299	348	SM00082	Cysteine-rich flanking region
IPR000372	365	397	SM00013	Leucine-rich repeat
IPR003591	391	415	SM00369	Leucine-rich repeat
NULL	416	437	SM00365	NULL
IPR003591	416	439	SM00369	Leucine-rich repeat
IPR003591	440	463	SM00369	Leucine-rich repeat
IPR003591	464	487	SM00369	Leucine-rich repeat
NULL	488	506	SM00365	NULL
IPR003591	488	511	SM00369	Leucine-rich repeat
IPR000483	523	572	SM00082	Cysteine-rich flanking region
IPR000372	596	628	SM00013	Leucine-rich repeat
NULL	648	669	SM00365	NULL
IPR003591	648	671	SM00369	Leucine-rich repeat
IPR003591	673	695	SM00369	Leucine-rich repeat
NULL	696	717	SM00365	NULL
IPR003591	696	719	SM00369	Leucine-rich repeat
NULL	720	741	SM00365	NULL
IPR003591	720	743	SM00369	Leucine-rich repeat
IPR000483	755	804	SM00082	Cysteine-rich flanking region
IPR000372	817	849	SM00013	Leucine-rich repeat
NULL	867	888	SM00365	NULL
IPR003591	867	890	SM00369	Leucine-rich repeat
NULL	891	912	SM00365	NULL
IPR003591	891	914	SM00369	Leucine-rich repeat
IPR003591	915	938	SM00369	Leucine-rich repeat
IPR000483	950	999	SM00082	Cysteine-rich flanking region
IPR001881	1009	1046	SM00179	EGF-like calcium-binding
IPR006210	1012	1046	SM00181	EGF
IPR001881	1048	1087	SM00179	EGF-like calcium-binding
IPR006210	1051	1087	SM00181	EGF
IPR001881	1089	1125	SM00179	EGF-like calcium-binding
IPR003645	1092	1114	SM00274	Follistatin-like
IPR006210	1092	1125	SM00181	EGF
IPR001881	1128	1165	SM00179	EGF-like calcium-binding
IPR006210	1130	1165	SM00181	EGF
IPR001881	1167	1203	SM00179	EGF-like calcium-binding
IPR006210	1170	1203	SM00181	EGF
IPR003645	1170	1192	SM00274	Follistatin-like
IPR006210	1214	1247	SM00181	EGF
IPR003645	1214	1236	SM00274	Follistatin-like
IPR001881	1215	1247	SM00179	EGF-like calcium-binding
IPR001791	1270	1406	SM00282	Laminin G
IPR006210	1425	1458	SM00181	EGF
IPR006210	1464	1497	SM00181	EGF
IPR001881	1465	1497	SM00179	EGF-like calcium-binding
IPR006210	1505	1538	SM00181	EGF
IPR003645	1505	1527	SM00274	Follistatin-like
IPR006207	1549	1618	SM00041	Cystine knot
ProfileScan	IPR000742	1011	1046	PS50026	EGF-like
IPR000742	1048	1087	PS50026	EGF-like
IPR000742	1089	1125	PS50026	EGF-like
IPR000742	1127	1165	PS50026	EGF-like
IPR000742	1167	1203	PS50026	EGF-like
IPR000742	1211	1247	PS50026	EGF-like
IPR001791	1250	1423	PS50025	Laminin G
IPR000742	1424	1458	PS50026	EGF-like
IPR000742	1461	1497	PS50026	EGF-like
IPR000742	1502	1538	PS50026	EGF-like
IPR006207	1543	1618	PS01225	Cystine knot
ScanRegExp	IPR013032	1034	1045	PS00022	EGF-like region
IPR013032	1034	1045	PS01186	EGF-like region
IPR013032	1075	1086	PS00022	EGF-like region
IPR013032	1075	1086	PS01186	EGF-like region
IPR001881	1089	1113	PS01187	EGF-like calcium-binding
IPR000152	1104	1115	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	1113	1124	PS00022	EGF-like region
IPR013032	1153	1164	PS00022	EGF-like region
IPR013032	1153	1164	PS01186	EGF-like region
IPR001881	1167	1191	PS01187	EGF-like calcium-binding
IPR000152	1182	1193	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	1191	1202	PS00022	EGF-like region
IPR013032	1191	1202	PS01186	EGF-like region
IPR013032	1235	1246	PS00022	EGF-like region
IPR013032	1235	1246	PS01186	EGF-like region
IPR013032	1446	1457	PS00022	EGF-like region
IPR013032	1446	1457	PS01186	EGF-like region
IPR013032	1485	1496	PS00022	EGF-like region
IPR013032	1485	1496	PS01186	EGF-like region
IPR013032	1526	1537	PS00022	EGF-like region
IPR013032	1526	1537	PS01186	EGF-like region
IPR006207	1581	1617	PS01185	Cystine knot

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAACAATACTTCCAGGGCAGG
Primer_r	: TCAGATGCTATGTGGTCGTGG
PCR product length	: 135 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3074 bp
Genome contig ID	gi89161187r_98647785
PolyA signal sequence (None)	+--------+--------+----*----+---- GTCTTCCATGTGAACATGACATTGAGTCACTCTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTTGTTGGTCTCTTTTTCTCCACCAAGGGCGGGCCGGGTGCTGCTGGCAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	98747785	98935673	37	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0813

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information