HUGE

Gene/Protein Characteristic Table for KIAA1776

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01697
Accession No. :	AB053450
Description :	Fibrillin-3 precursor.
HUGO Gene Name :
Clone Name :	fh11044s3 [Vector Info]
Flexi ORF Clone :	pF1KA1776
Source :	Human fetal brain
Note :	We replaced fh11044x1, former representative clones for KIAA1776 with fh11044s3. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 8966 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 515 bp

Genome contig ID gi42406306r_7936288
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
CAAAAGTGGAGACGATAATAAAGTTATTTTGGGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGTCTGCCTGCCCTTTGGCAAGTTCTTGAAGTAAGTAGATGCTGCCCTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 8036288 8118385 63 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 2816 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAB47408	100.0	fibrillin3 [Hom...	Homo sapiens
AAI53883	100.0	Fibrillin 3 [Ho...	Homo sapiens
Q75N90	99.9	Fibrillin-3; Fl...	Homo sapiens
NP_115823	99.9	fibrillin 3 pre...	Homo sapiens
BAD16733	99.9	fibrillin 3 [Ho...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011539	1.4e-42	28.8	KIAA0815
AB058677	2.3e-20	28.5	KIAA1781
D87433	2e-16	23.5	KIAA0246
AB058676	3.7e-16	27.1	KIAA1780
AB011537	8.8e-14	22.9	KIAA0813

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006209 127 153 PF00008 EGF-like

IPR002212 201 243 PF00683 Matrix fibril-associated

IPR013091 254 294 PF07645 EGF calcium-binding

IPR002212 309 352 PF00683 Matrix fibril-associated

IPR006209 419 449 PF00008 EGF-like

IPR013091 456 494 PF07645 EGF calcium-binding

IPR013091 496 536 PF07645 EGF calcium-binding

IPR013091 538 577 PF07645 EGF calcium-binding

IPR013091 579 618 PF07645 EGF calcium-binding

IPR002212 634 676 PF00683 Matrix fibril-associated

IPR013091 689 729 PF07645 EGF calcium-binding

IPR013091 731 771 PF07645 EGF calcium-binding

IPR013091 773 811 PF07645 EGF calcium-binding

IPR002212 826 865 PF00683 Matrix fibril-associated

IPR013091 876 916 PF07645 EGF calcium-binding

IPR002212 931 972 PF00683 Matrix fibril-associated

IPR013091 993 1033 PF07645 EGF calcium-binding

IPR013091 1035 1076 PF07645 EGF calcium-binding

IPR013091 1078 1118 PF07645 EGF calcium-binding

IPR013091 1120 1160 PF07645 EGF calcium-binding

IPR013091 1162 1201 PF07645 EGF calcium-binding

IPR013091 1203 1243 PF07645 EGF calcium-binding

IPR013091 1245 1285 PF07645 EGF calcium-binding

IPR013091 1287 1326 PF07645 EGF calcium-binding

IPR013091 1328 1367 PF07645 EGF calcium-binding

IPR013091 1369 1409 PF07645 EGF calcium-binding

IPR013091 1411 1450 PF07645 EGF calcium-binding

IPR013091 1452 1499 PF07645 EGF calcium-binding

IPR002212 1511 1552 PF00683 Matrix fibril-associated

IPR013091 1570 1610 PF07645 EGF calcium-binding

IPR002212 1666 1709 PF00683 Matrix fibril-associated

IPR013091 1728 1768 PF07645 EGF calcium-binding

IPR013091 1770 1810 PF07645 EGF calcium-binding

IPR013091 1814 1852 PF07645 EGF calcium-binding

IPR013091 1854 1891 PF07645 EGF calcium-binding

IPR013091 1893 1934 PF07645 EGF calcium-binding

IPR013091 1936 1974 PF07645 EGF calcium-binding

IPR013091 1976 2016 PF07645 EGF calcium-binding

IPR002212 2031 2074 PF00683 Matrix fibril-associated

IPR013091 2091 2131 PF07645 EGF calcium-binding

IPR013091 2133 2171 PF07645 EGF calcium-binding

IPR013091 2173 2212 PF07645 EGF calcium-binding

IPR013091 2214 2257 PF07645 EGF calcium-binding

IPR013091 2259 2299 PF07645 EGF calcium-binding

IPR002212 2314 2357 PF00683 Matrix fibril-associated

IPR013091 2370 2410 PF07645 EGF calcium-binding

IPR013091 2412 2451 PF07645 EGF calcium-binding

IPR013091 2453 2490 PF07645 EGF calcium-binding

IPR006209 2496 2533 PF00008 EGF-like

IPR013091 2535 2573 PF07645 EGF calcium-binding

IPR013091 2575 2615 PF07645 EGF calcium-binding

IPR013091 2617 2655 PF07645 EGF calcium-binding

HMMSmart IPR006210 92 120 SM00181 EGF

IPR006210 126 154 SM00181 EGF

IPR006210 157 186 SM00181 EGF

IPR001881 254 295 SM00179 EGF-like calcium-binding

IPR006210 257 295 SM00181 EGF

IPR001881 417 455 SM00179 EGF-like calcium-binding

IPR006210 418 455 SM00181 EGF

IPR001881 456 495 SM00179 EGF-like calcium-binding

IPR006210 459 495 SM00181 EGF

IPR001881 496 537 SM00179 EGF-like calcium-binding

IPR006210 499 537 SM00181 EGF

IPR001881 538 578 SM00179 EGF-like calcium-binding

IPR006210 541 578 SM00181 EGF

IPR001881 579 619 SM00179 EGF-like calcium-binding

IPR006210 582 619 SM00181 EGF

IPR001881 689 730 SM00179 EGF-like calcium-binding

IPR006210 692 730 SM00181 EGF

IPR001881 731 772 SM00179 EGF-like calcium-binding

IPR006210 734 772 SM00181 EGF

IPR001881 773 812 SM00179 EGF-like calcium-binding

IPR006210 776 812 SM00181 EGF

IPR001881 876 917 SM00179 EGF-like calcium-binding

IPR006210 879 917 SM00181 EGF

IPR001881 993 1034 SM00179 EGF-like calcium-binding

IPR006210 996 1034 SM00181 EGF

IPR001881 1035 1077 SM00179 EGF-like calcium-binding

IPR006210 1038 1077 SM00181 EGF

IPR001881 1078 1119 SM00179 EGF-like calcium-binding

IPR006210 1081 1119 SM00181 EGF

IPR001881 1120 1161 SM00179 EGF-like calcium-binding

IPR006210 1123 1161 SM00181 EGF

IPR001881 1162 1202 SM00179 EGF-like calcium-binding

IPR006210 1165 1202 SM00181 EGF

IPR001881 1203 1244 SM00179 EGF-like calcium-binding

IPR006210 1206 1244 SM00181 EGF

IPR001881 1245 1286 SM00179 EGF-like calcium-binding

IPR006210 1248 1286 SM00181 EGF

IPR001881 1287 1327 SM00179 EGF-like calcium-binding

IPR006210 1290 1327 SM00181 EGF

IPR001881 1328 1368 SM00179 EGF-like calcium-binding

IPR006210 1331 1368 SM00181 EGF

IPR001881 1369 1410 SM00179 EGF-like calcium-binding

IPR006210 1372 1410 SM00181 EGF

IPR001881 1411 1451 SM00179 EGF-like calcium-binding

IPR006210 1414 1451 SM00181 EGF

IPR001881 1452 1492 SM00179 EGF-like calcium-binding

IPR006210 1455 1492 SM00181 EGF

IPR001881 1570 1611 SM00179 EGF-like calcium-binding

IPR006210 1573 1611 SM00181 EGF

IPR001881 1612 1653 SM00179 EGF-like calcium-binding

IPR006210 1615 1653 SM00181 EGF

IPR001881 1728 1769 SM00179 EGF-like calcium-binding

IPR006210 1731 1769 SM00181 EGF

IPR001881 1770 1811 SM00179 EGF-like calcium-binding

IPR006210 1773 1811 SM00181 EGF

IPR001881 1814 1853 SM00179 EGF-like calcium-binding

IPR006210 1815 1853 SM00181 EGF

IPR001881 1854 1892 SM00179 EGF-like calcium-binding

IPR006210 1857 1892 SM00181 EGF

IPR001881 1893 1935 SM00179 EGF-like calcium-binding

IPR006210 1896 1935 SM00181 EGF

IPR001881 1936 1975 SM00179 EGF-like calcium-binding

IPR006210 1939 1975 SM00181 EGF

IPR001881 1976 2017 SM00179 EGF-like calcium-binding

IPR006210 1979 2017 SM00181 EGF

IPR001881 2091 2132 SM00179 EGF-like calcium-binding

IPR006210 2094 2132 SM00181 EGF

IPR001881 2133 2172 SM00179 EGF-like calcium-binding

IPR006210 2136 2172 SM00181 EGF

IPR001881 2173 2213 SM00179 EGF-like calcium-binding

IPR006210 2176 2213 SM00181 EGF

IPR001881 2214 2258 SM00179 EGF-like calcium-binding

IPR006210 2217 2258 SM00181 EGF

IPR001881 2259 2300 SM00179 EGF-like calcium-binding

IPR006210 2262 2300 SM00181 EGF

IPR001881 2370 2411 SM00179 EGF-like calcium-binding

IPR006210 2373 2411 SM00181 EGF

IPR001881 2412 2452 SM00179 EGF-like calcium-binding

IPR006210 2415 2452 SM00181 EGF

IPR001881 2453 2491 SM00179 EGF-like calcium-binding

IPR006210 2456 2491 SM00181 EGF

IPR001881 2492 2534 SM00179 EGF-like calcium-binding

IPR006210 2495 2534 SM00181 EGF

IPR001881 2535 2574 SM00179 EGF-like calcium-binding

IPR006210 2538 2574 SM00181 EGF

IPR001881 2575 2616 SM00179 EGF-like calcium-binding

IPR006210 2578 2616 SM00181 EGF

IPR001881 2617 2656 SM00179 EGF-like calcium-binding

IPR006210 2620 2656 SM00181 EGF

ProfileScan IPR000742 154 186 PS50026 EGF-like

IPR000742 254 291 PS50026 EGF-like

IPR000742 415 453 PS50026 EGF-like

IPR000742 456 495 PS50026 EGF-like

IPR000742 496 537 PS50026 EGF-like

IPR000742 538 578 PS50026 EGF-like

IPR000742 579 619 PS50026 EGF-like

IPR000742 689 730 PS50026 EGF-like

IPR000742 731 772 PS50026 EGF-like

IPR000742 773 812 PS50026 EGF-like

IPR000742 876 917 PS50026 EGF-like

IPR000742 993 1034 PS50026 EGF-like

IPR000742 1035 1077 PS50026 EGF-like

IPR000742 1078 1119 PS50026 EGF-like

IPR000742 1120 1161 PS50026 EGF-like

IPR000742 1162 1202 PS50026 EGF-like

IPR000742 1203 1244 PS50026 EGF-like

IPR000742 1245 1282 PS50026 EGF-like

IPR000742 1287 1325 PS50026 EGF-like

IPR000742 1328 1368 PS50026 EGF-like

IPR000742 1369 1410 PS50026 EGF-like

IPR000742 1411 1447 PS50026 EGF-like

IPR000742 1452 1492 PS50026 EGF-like

IPR000742 1570 1611 PS50026 EGF-like

IPR000742 1612 1653 PS50026 EGF-like

IPR000742 1728 1769 PS50026 EGF-like

IPR000742 1770 1811 PS50026 EGF-like

IPR000742 1812 1853 PS50026 EGF-like

IPR000742 1854 1889 PS50026 EGF-like

IPR000742 1893 1935 PS50026 EGF-like

IPR000742 1936 1975 PS50026 EGF-like

IPR000742 1976 2017 PS50026 EGF-like

IPR000742 2091 2132 PS50026 EGF-like

IPR000742 2133 2172 PS50026 EGF-like

IPR000742 2173 2213 PS50026 EGF-like

IPR000742 2214 2258 PS50026 EGF-like

IPR000742 2259 2300 PS50026 EGF-like

IPR000742 2370 2411 PS50026 EGF-like

IPR000742 2412 2452 PS50026 EGF-like

IPR000742 2453 2489 PS50026 EGF-like

IPR000742 2492 2534 PS50026 EGF-like

IPR000742 2535 2574 PS50026 EGF-like

IPR000742 2575 2612 PS50026 EGF-like

IPR000742 2617 2656 PS50026 EGF-like

ScanRegExp IPR013032 142 153 PS00022 EGF-like region

IPR013032 142 153 PS01186 EGF-like region

IPR013032 174 185 PS00022 EGF-like region

IPR013032 174 185 PS01186 EGF-like region

IPR001881 254 279 PS01187 EGF-like calcium-binding

IPR000152 270 281 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 440 454 PS01186 EGF-like region

IPR001881 456 479 PS01187 EGF-like calcium-binding

IPR000152 470 481 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 479 494 PS01186 EGF-like region

IPR001881 496 521 PS01187 EGF-like calcium-binding

IPR000152 512 523 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 521 536 PS01186 EGF-like region

IPR001881 538 562 PS01187 EGF-like calcium-binding

IPR000152 553 564 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 562 577 PS01186 EGF-like region

IPR001881 579 603 PS01187 EGF-like calcium-binding

IPR000152 594 605 PS00010 Aspartic acid and asparagine hydroxylation site

IPR001881 689 714 PS01187 EGF-like calcium-binding

IPR000152 705 716 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 714 729 PS01186 EGF-like region

IPR001881 731 756 PS01187 EGF-like calcium-binding

IPR000152 747 758 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 756 771 PS01186 EGF-like region

IPR001881 773 796 PS01187 EGF-like calcium-binding

IPR000152 787 798 PS00010 Aspartic acid and asparagine hydroxylation site

IPR001881 876 901 PS01187 EGF-like calcium-binding

IPR000152 892 903 PS00010 Aspartic acid and asparagine hydroxylation site

IPR001881 993 1018 PS01187 EGF-like calcium-binding

IPR000152 1009 1020 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 1018 1033 PS01186 EGF-like region

IPR001881 1035 1060 PS01187 EGF-like calcium-binding

IPR000152 1051 1062 PS00010 Aspartic acid and asparagine hydroxylation site

IPR001881 1078 1103 PS01187 EGF-like calcium-binding

IPR000152 1094 1105 PS00010 Aspartic acid and asparagine hydroxylation site

IPR001881 1120 1145 PS01187 EGF-like calcium-binding

IPR000152 1136 1147 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 1145 1160 PS01186 EGF-like region

IPR001881 1162 1186 PS01187 EGF-like calcium-binding

IPR000152 1177 1188 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 1186 1201 PS01186 EGF-like region

IPR013032 1228 1243 PS01186 EGF-like region

IPR001881 1245 1270 PS01187 EGF-like calcium-binding

IPR000152 1261 1272 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 1270 1285 PS01186 EGF-like region

IPR001881 1287 1313 PS01187 EGF-like calcium-binding

IPR000152 1304 1315 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 1313 1326 PS01186 EGF-like region

IPR001881 1328 1354 PS01187 EGF-like calcium-binding

IPR000152 1345 1356 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 1354 1367 PS01186 EGF-like region

IPR001881 1369 1394 PS01187 EGF-like calcium-binding

IPR000152 1385 1396 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 1394 1409 PS01186 EGF-like region

IPR001881 1411 1435 PS01187 EGF-like calcium-binding

IPR000152 1426 1437 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 1435 1450 PS01186 EGF-like region

IPR001881 1452 1476 PS01187 EGF-like calcium-binding

IPR000152 1467 1478 PS00010 Aspartic acid and asparagine hydroxylation site

IPR001881 1570 1595 PS01187 EGF-like calcium-binding

IPR000152 1586 1597 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 1595 1610 PS01186 EGF-like region

IPR001881 1612 1637 PS01187 EGF-like calcium-binding

IPR000152 1628 1639 PS00010 Aspartic acid and asparagine hydroxylation site

IPR001881 1728 1753 PS01187 EGF-like calcium-binding

IPR000152 1744 1755 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 1753 1768 PS01186 EGF-like region

IPR001881 1770 1796 PS01187 EGF-like calcium-binding

IPR000152 1787 1798 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 1796 1810 PS01186 EGF-like region

IPR000152 1828 1839 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 1837 1852 PS01186 EGF-like region

IPR001881 1854 1877 PS01187 EGF-like calcium-binding

IPR000152 1868 1879 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 1877 1891 PS01186 EGF-like region

IPR001881 1893 1919 PS01187 EGF-like calcium-binding

IPR000152 1910 1921 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 1919 1934 PS01186 EGF-like region

IPR001881 1936 1961 PS01187 EGF-like calcium-binding

IPR000152 1952 1963 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 1961 1974 PS01186 EGF-like region

IPR001881 1976 2001 PS01187 EGF-like calcium-binding

IPR000152 1992 2003 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 2001 2016 PS01186 EGF-like region

IPR001881 2091 2116 PS01187 EGF-like calcium-binding

IPR000152 2107 2118 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 2116 2131 PS01186 EGF-like region

IPR001881 2133 2157 PS01187 EGF-like calcium-binding

IPR000152 2148 2159 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 2157 2171 PS01186 EGF-like region

IPR001881 2173 2197 PS01187 EGF-like calcium-binding

IPR000152 2188 2199 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 2197 2212 PS01186 EGF-like region

IPR001881 2214 2241 PS01187 EGF-like calcium-binding

IPR000152 2232 2243 PS00010 Aspartic acid and asparagine hydroxylation site

IPR001881 2259 2284 PS01187 EGF-like calcium-binding

IPR000152 2275 2286 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 2284 2299 PS01186 EGF-like region

IPR001881 2370 2395 PS01187 EGF-like calcium-binding

IPR000152 2386 2397 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 2395 2410 PS01186 EGF-like region

IPR001881 2412 2436 PS01187 EGF-like calcium-binding

IPR000152 2427 2438 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 2436 2451 PS01186 EGF-like region

IPR001881 2453 2477 PS01187 EGF-like calcium-binding

IPR000152 2468 2479 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 2477 2490 PS01186 EGF-like region

IPR001881 2492 2518 PS01187 EGF-like calcium-binding

IPR000152 2509 2520 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 2518 2533 PS01186 EGF-like region

IPR001881 2535 2558 PS01187 EGF-like calcium-binding

IPR000152 2549 2560 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 2558 2573 PS01186 EGF-like region

IPR001881 2575 2600 PS01187 EGF-like calcium-binding

IPR000152 2591 2602 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 2600 2615 PS01186 EGF-like region

IPR001881 2617 2641 PS01187 EGF-like calcium-binding

IPR000152 2632 2643 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 2641 2655 PS01186 EGF-like region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006209	127	153	PF00008	EGF-like
IPR002212	201	243	PF00683	Matrix fibril-associated
IPR013091	254	294	PF07645	EGF calcium-binding
IPR002212	309	352	PF00683	Matrix fibril-associated
IPR006209	419	449	PF00008	EGF-like
IPR013091	456	494	PF07645	EGF calcium-binding
IPR013091	496	536	PF07645	EGF calcium-binding
IPR013091	538	577	PF07645	EGF calcium-binding
IPR013091	579	618	PF07645	EGF calcium-binding
IPR002212	634	676	PF00683	Matrix fibril-associated
IPR013091	689	729	PF07645	EGF calcium-binding
IPR013091	731	771	PF07645	EGF calcium-binding
IPR013091	773	811	PF07645	EGF calcium-binding
IPR002212	826	865	PF00683	Matrix fibril-associated
IPR013091	876	916	PF07645	EGF calcium-binding
IPR002212	931	972	PF00683	Matrix fibril-associated
IPR013091	993	1033	PF07645	EGF calcium-binding
IPR013091	1035	1076	PF07645	EGF calcium-binding
IPR013091	1078	1118	PF07645	EGF calcium-binding
IPR013091	1120	1160	PF07645	EGF calcium-binding
IPR013091	1162	1201	PF07645	EGF calcium-binding
IPR013091	1203	1243	PF07645	EGF calcium-binding
IPR013091	1245	1285	PF07645	EGF calcium-binding
IPR013091	1287	1326	PF07645	EGF calcium-binding
IPR013091	1328	1367	PF07645	EGF calcium-binding
IPR013091	1369	1409	PF07645	EGF calcium-binding
IPR013091	1411	1450	PF07645	EGF calcium-binding
IPR013091	1452	1499	PF07645	EGF calcium-binding
IPR002212	1511	1552	PF00683	Matrix fibril-associated
IPR013091	1570	1610	PF07645	EGF calcium-binding
IPR002212	1666	1709	PF00683	Matrix fibril-associated
IPR013091	1728	1768	PF07645	EGF calcium-binding
IPR013091	1770	1810	PF07645	EGF calcium-binding
IPR013091	1814	1852	PF07645	EGF calcium-binding
IPR013091	1854	1891	PF07645	EGF calcium-binding
IPR013091	1893	1934	PF07645	EGF calcium-binding
IPR013091	1936	1974	PF07645	EGF calcium-binding
IPR013091	1976	2016	PF07645	EGF calcium-binding
IPR002212	2031	2074	PF00683	Matrix fibril-associated
IPR013091	2091	2131	PF07645	EGF calcium-binding
IPR013091	2133	2171	PF07645	EGF calcium-binding
IPR013091	2173	2212	PF07645	EGF calcium-binding
IPR013091	2214	2257	PF07645	EGF calcium-binding
IPR013091	2259	2299	PF07645	EGF calcium-binding
IPR002212	2314	2357	PF00683	Matrix fibril-associated
IPR013091	2370	2410	PF07645	EGF calcium-binding
IPR013091	2412	2451	PF07645	EGF calcium-binding
IPR013091	2453	2490	PF07645	EGF calcium-binding
IPR006209	2496	2533	PF00008	EGF-like
IPR013091	2535	2573	PF07645	EGF calcium-binding
IPR013091	2575	2615	PF07645	EGF calcium-binding
IPR013091	2617	2655	PF07645	EGF calcium-binding
HMMSmart	IPR006210	92	120	SM00181	EGF
IPR006210	126	154	SM00181	EGF
IPR006210	157	186	SM00181	EGF
IPR001881	254	295	SM00179	EGF-like calcium-binding
IPR006210	257	295	SM00181	EGF
IPR001881	417	455	SM00179	EGF-like calcium-binding
IPR006210	418	455	SM00181	EGF
IPR001881	456	495	SM00179	EGF-like calcium-binding
IPR006210	459	495	SM00181	EGF
IPR001881	496	537	SM00179	EGF-like calcium-binding
IPR006210	499	537	SM00181	EGF
IPR001881	538	578	SM00179	EGF-like calcium-binding
IPR006210	541	578	SM00181	EGF
IPR001881	579	619	SM00179	EGF-like calcium-binding
IPR006210	582	619	SM00181	EGF
IPR001881	689	730	SM00179	EGF-like calcium-binding
IPR006210	692	730	SM00181	EGF
IPR001881	731	772	SM00179	EGF-like calcium-binding
IPR006210	734	772	SM00181	EGF
IPR001881	773	812	SM00179	EGF-like calcium-binding
IPR006210	776	812	SM00181	EGF
IPR001881	876	917	SM00179	EGF-like calcium-binding
IPR006210	879	917	SM00181	EGF
IPR001881	993	1034	SM00179	EGF-like calcium-binding
IPR006210	996	1034	SM00181	EGF
IPR001881	1035	1077	SM00179	EGF-like calcium-binding
IPR006210	1038	1077	SM00181	EGF
IPR001881	1078	1119	SM00179	EGF-like calcium-binding
IPR006210	1081	1119	SM00181	EGF
IPR001881	1120	1161	SM00179	EGF-like calcium-binding
IPR006210	1123	1161	SM00181	EGF
IPR001881	1162	1202	SM00179	EGF-like calcium-binding
IPR006210	1165	1202	SM00181	EGF
IPR001881	1203	1244	SM00179	EGF-like calcium-binding
IPR006210	1206	1244	SM00181	EGF
IPR001881	1245	1286	SM00179	EGF-like calcium-binding
IPR006210	1248	1286	SM00181	EGF
IPR001881	1287	1327	SM00179	EGF-like calcium-binding
IPR006210	1290	1327	SM00181	EGF
IPR001881	1328	1368	SM00179	EGF-like calcium-binding
IPR006210	1331	1368	SM00181	EGF
IPR001881	1369	1410	SM00179	EGF-like calcium-binding
IPR006210	1372	1410	SM00181	EGF
IPR001881	1411	1451	SM00179	EGF-like calcium-binding
IPR006210	1414	1451	SM00181	EGF
IPR001881	1452	1492	SM00179	EGF-like calcium-binding
IPR006210	1455	1492	SM00181	EGF
IPR001881	1570	1611	SM00179	EGF-like calcium-binding
IPR006210	1573	1611	SM00181	EGF
IPR001881	1612	1653	SM00179	EGF-like calcium-binding
IPR006210	1615	1653	SM00181	EGF
IPR001881	1728	1769	SM00179	EGF-like calcium-binding
IPR006210	1731	1769	SM00181	EGF
IPR001881	1770	1811	SM00179	EGF-like calcium-binding
IPR006210	1773	1811	SM00181	EGF
IPR001881	1814	1853	SM00179	EGF-like calcium-binding
IPR006210	1815	1853	SM00181	EGF
IPR001881	1854	1892	SM00179	EGF-like calcium-binding
IPR006210	1857	1892	SM00181	EGF
IPR001881	1893	1935	SM00179	EGF-like calcium-binding
IPR006210	1896	1935	SM00181	EGF
IPR001881	1936	1975	SM00179	EGF-like calcium-binding
IPR006210	1939	1975	SM00181	EGF
IPR001881	1976	2017	SM00179	EGF-like calcium-binding
IPR006210	1979	2017	SM00181	EGF
IPR001881	2091	2132	SM00179	EGF-like calcium-binding
IPR006210	2094	2132	SM00181	EGF
IPR001881	2133	2172	SM00179	EGF-like calcium-binding
IPR006210	2136	2172	SM00181	EGF
IPR001881	2173	2213	SM00179	EGF-like calcium-binding
IPR006210	2176	2213	SM00181	EGF
IPR001881	2214	2258	SM00179	EGF-like calcium-binding
IPR006210	2217	2258	SM00181	EGF
IPR001881	2259	2300	SM00179	EGF-like calcium-binding
IPR006210	2262	2300	SM00181	EGF
IPR001881	2370	2411	SM00179	EGF-like calcium-binding
IPR006210	2373	2411	SM00181	EGF
IPR001881	2412	2452	SM00179	EGF-like calcium-binding
IPR006210	2415	2452	SM00181	EGF
IPR001881	2453	2491	SM00179	EGF-like calcium-binding
IPR006210	2456	2491	SM00181	EGF
IPR001881	2492	2534	SM00179	EGF-like calcium-binding
IPR006210	2495	2534	SM00181	EGF
IPR001881	2535	2574	SM00179	EGF-like calcium-binding
IPR006210	2538	2574	SM00181	EGF
IPR001881	2575	2616	SM00179	EGF-like calcium-binding
IPR006210	2578	2616	SM00181	EGF
IPR001881	2617	2656	SM00179	EGF-like calcium-binding
IPR006210	2620	2656	SM00181	EGF
ProfileScan	IPR000742	154	186	PS50026	EGF-like
IPR000742	254	291	PS50026	EGF-like
IPR000742	415	453	PS50026	EGF-like
IPR000742	456	495	PS50026	EGF-like
IPR000742	496	537	PS50026	EGF-like
IPR000742	538	578	PS50026	EGF-like
IPR000742	579	619	PS50026	EGF-like
IPR000742	689	730	PS50026	EGF-like
IPR000742	731	772	PS50026	EGF-like
IPR000742	773	812	PS50026	EGF-like
IPR000742	876	917	PS50026	EGF-like
IPR000742	993	1034	PS50026	EGF-like
IPR000742	1035	1077	PS50026	EGF-like
IPR000742	1078	1119	PS50026	EGF-like
IPR000742	1120	1161	PS50026	EGF-like
IPR000742	1162	1202	PS50026	EGF-like
IPR000742	1203	1244	PS50026	EGF-like
IPR000742	1245	1282	PS50026	EGF-like
IPR000742	1287	1325	PS50026	EGF-like
IPR000742	1328	1368	PS50026	EGF-like
IPR000742	1369	1410	PS50026	EGF-like
IPR000742	1411	1447	PS50026	EGF-like
IPR000742	1452	1492	PS50026	EGF-like
IPR000742	1570	1611	PS50026	EGF-like
IPR000742	1612	1653	PS50026	EGF-like
IPR000742	1728	1769	PS50026	EGF-like
IPR000742	1770	1811	PS50026	EGF-like
IPR000742	1812	1853	PS50026	EGF-like
IPR000742	1854	1889	PS50026	EGF-like
IPR000742	1893	1935	PS50026	EGF-like
IPR000742	1936	1975	PS50026	EGF-like
IPR000742	1976	2017	PS50026	EGF-like
IPR000742	2091	2132	PS50026	EGF-like
IPR000742	2133	2172	PS50026	EGF-like
IPR000742	2173	2213	PS50026	EGF-like
IPR000742	2214	2258	PS50026	EGF-like
IPR000742	2259	2300	PS50026	EGF-like
IPR000742	2370	2411	PS50026	EGF-like
IPR000742	2412	2452	PS50026	EGF-like
IPR000742	2453	2489	PS50026	EGF-like
IPR000742	2492	2534	PS50026	EGF-like
IPR000742	2535	2574	PS50026	EGF-like
IPR000742	2575	2612	PS50026	EGF-like
IPR000742	2617	2656	PS50026	EGF-like
ScanRegExp	IPR013032	142	153	PS00022	EGF-like region
IPR013032	142	153	PS01186	EGF-like region
IPR013032	174	185	PS00022	EGF-like region
IPR013032	174	185	PS01186	EGF-like region
IPR001881	254	279	PS01187	EGF-like calcium-binding
IPR000152	270	281	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	440	454	PS01186	EGF-like region
IPR001881	456	479	PS01187	EGF-like calcium-binding
IPR000152	470	481	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	479	494	PS01186	EGF-like region
IPR001881	496	521	PS01187	EGF-like calcium-binding
IPR000152	512	523	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	521	536	PS01186	EGF-like region
IPR001881	538	562	PS01187	EGF-like calcium-binding
IPR000152	553	564	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	562	577	PS01186	EGF-like region
IPR001881	579	603	PS01187	EGF-like calcium-binding
IPR000152	594	605	PS00010	Aspartic acid and asparagine hydroxylation site
IPR001881	689	714	PS01187	EGF-like calcium-binding
IPR000152	705	716	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	714	729	PS01186	EGF-like region
IPR001881	731	756	PS01187	EGF-like calcium-binding
IPR000152	747	758	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	756	771	PS01186	EGF-like region
IPR001881	773	796	PS01187	EGF-like calcium-binding
IPR000152	787	798	PS00010	Aspartic acid and asparagine hydroxylation site
IPR001881	876	901	PS01187	EGF-like calcium-binding
IPR000152	892	903	PS00010	Aspartic acid and asparagine hydroxylation site
IPR001881	993	1018	PS01187	EGF-like calcium-binding
IPR000152	1009	1020	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	1018	1033	PS01186	EGF-like region
IPR001881	1035	1060	PS01187	EGF-like calcium-binding
IPR000152	1051	1062	PS00010	Aspartic acid and asparagine hydroxylation site
IPR001881	1078	1103	PS01187	EGF-like calcium-binding
IPR000152	1094	1105	PS00010	Aspartic acid and asparagine hydroxylation site
IPR001881	1120	1145	PS01187	EGF-like calcium-binding
IPR000152	1136	1147	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	1145	1160	PS01186	EGF-like region
IPR001881	1162	1186	PS01187	EGF-like calcium-binding
IPR000152	1177	1188	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	1186	1201	PS01186	EGF-like region
IPR013032	1228	1243	PS01186	EGF-like region
IPR001881	1245	1270	PS01187	EGF-like calcium-binding
IPR000152	1261	1272	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	1270	1285	PS01186	EGF-like region
IPR001881	1287	1313	PS01187	EGF-like calcium-binding
IPR000152	1304	1315	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	1313	1326	PS01186	EGF-like region
IPR001881	1328	1354	PS01187	EGF-like calcium-binding
IPR000152	1345	1356	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	1354	1367	PS01186	EGF-like region
IPR001881	1369	1394	PS01187	EGF-like calcium-binding
IPR000152	1385	1396	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	1394	1409	PS01186	EGF-like region
IPR001881	1411	1435	PS01187	EGF-like calcium-binding
IPR000152	1426	1437	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	1435	1450	PS01186	EGF-like region
IPR001881	1452	1476	PS01187	EGF-like calcium-binding
IPR000152	1467	1478	PS00010	Aspartic acid and asparagine hydroxylation site
IPR001881	1570	1595	PS01187	EGF-like calcium-binding
IPR000152	1586	1597	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	1595	1610	PS01186	EGF-like region
IPR001881	1612	1637	PS01187	EGF-like calcium-binding
IPR000152	1628	1639	PS00010	Aspartic acid and asparagine hydroxylation site
IPR001881	1728	1753	PS01187	EGF-like calcium-binding
IPR000152	1744	1755	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	1753	1768	PS01186	EGF-like region
IPR001881	1770	1796	PS01187	EGF-like calcium-binding
IPR000152	1787	1798	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	1796	1810	PS01186	EGF-like region
IPR000152	1828	1839	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	1837	1852	PS01186	EGF-like region
IPR001881	1854	1877	PS01187	EGF-like calcium-binding
IPR000152	1868	1879	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	1877	1891	PS01186	EGF-like region
IPR001881	1893	1919	PS01187	EGF-like calcium-binding
IPR000152	1910	1921	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	1919	1934	PS01186	EGF-like region
IPR001881	1936	1961	PS01187	EGF-like calcium-binding
IPR000152	1952	1963	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	1961	1974	PS01186	EGF-like region
IPR001881	1976	2001	PS01187	EGF-like calcium-binding
IPR000152	1992	2003	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	2001	2016	PS01186	EGF-like region
IPR001881	2091	2116	PS01187	EGF-like calcium-binding
IPR000152	2107	2118	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	2116	2131	PS01186	EGF-like region
IPR001881	2133	2157	PS01187	EGF-like calcium-binding
IPR000152	2148	2159	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	2157	2171	PS01186	EGF-like region
IPR001881	2173	2197	PS01187	EGF-like calcium-binding
IPR000152	2188	2199	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	2197	2212	PS01186	EGF-like region
IPR001881	2214	2241	PS01187	EGF-like calcium-binding
IPR000152	2232	2243	PS00010	Aspartic acid and asparagine hydroxylation site
IPR001881	2259	2284	PS01187	EGF-like calcium-binding
IPR000152	2275	2286	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	2284	2299	PS01186	EGF-like region
IPR001881	2370	2395	PS01187	EGF-like calcium-binding
IPR000152	2386	2397	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	2395	2410	PS01186	EGF-like region
IPR001881	2412	2436	PS01187	EGF-like calcium-binding
IPR000152	2427	2438	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	2436	2451	PS01186	EGF-like region
IPR001881	2453	2477	PS01187	EGF-like calcium-binding
IPR000152	2468	2479	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	2477	2490	PS01186	EGF-like region
IPR001881	2492	2518	PS01187	EGF-like calcium-binding
IPR000152	2509	2520	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	2518	2533	PS01186	EGF-like region
IPR001881	2535	2558	PS01187	EGF-like calcium-binding
IPR000152	2549	2560	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	2558	2573	PS01186	EGF-like region
IPR001881	2575	2600	PS01187	EGF-like calcium-binding
IPR000152	2591	2602	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	2600	2615	PS01186	EGF-like region
IPR001881	2617	2641	PS01187	EGF-like calcium-binding
IPR000152	2632	2643	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	2641	2655	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GAAATGCTACACGACAACCTC

Primer_r
: GAAGTGAAAGCCTGAGATTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: RH-map
Primer_f	: GAAATGCTACACGACAACCTC
Primer_r	: GAAGTGAAAGCCTGAGATTGG
PCR product length	: 194 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	515 bp
Genome contig ID	gi42406306r_7936288
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CAAAAGTGGAGACGATAATAAAGTTATTTTGGGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTCTGCCTGCCCTTTGGCAAGTTCTTGAAGTAAGTAGATGCTGCCCTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	8036288	8118385	63	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA1776

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information