HUGE

Gene/Protein Characteristic Table for KIAA1910

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00297
Accession No. :	AB067497
Description :	SLIT and NTRK-like protein 1 precursor.
HUGO Gene Name :	SLIT and NTRK-like family, member 1 (SLITRK1)
Clone Name :	fh21867 [Vector Info]
Flexi ORF Clone :	pF1KA1910
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5187 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2211 bp

Genome contig ID gi51511729r_83249342
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
ACACTTTTTTAATAAAATCTTTATTATAAACCATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTATTCCTAAGGCCATTCATCATTTTCTCTCTTGATTCTTTTGTTTGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 r 83349342 83354529 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 760 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96PX8	100.0	SLIT and NTRK-l...	Homo sapiens
AAH51738	99.9	SLIT and NTRK-l...	Homo sapiens
XP_001143864	99.9	slit and trk li...	Pan troglodytes
XP_001093240	99.7	similar to slit...	Macaca mulatta
BAG61443	99.7	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058757	3e-71	46.5	KIAA1854
AB020725	6.7e-38	41.2	KIAA0918
AB020655	8.5e-34	38.8	KIAA0848
AB011538	2.4e-12	23.7	KIAA0814
AB011537	5.1e-11	24.5	KIAA0813

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 243 256 PR00019 Leucine-rich repeat

IPR001611 510 523 PR00019 Leucine-rich repeat

HMMPfam IPR001611 123 145 PF00560 Leucine-rich repeat

IPR001611 195 217 PF00560 Leucine-rich repeat

IPR001611 219 241 PF00560 Leucine-rich repeat

IPR001611 440 462 PF00560 Leucine-rich repeat

IPR001611 464 486 PF00560 Leucine-rich repeat

IPR001611 488 510 PF00560 Leucine-rich repeat

IPR001611 512 534 PF00560 Leucine-rich repeat

IPR001611 536 558 PF00560 Leucine-rich repeat

HMMSmart IPR003591 145 168 SM00369 Leucine-rich repeat

IPR003591 169 192 SM00369 Leucine-rich repeat

IPR003591 193 216 SM00369 Leucine-rich repeat

IPR003591 217 240 SM00369 Leucine-rich repeat

IPR003591 244 264 SM00369 Leucine-rich repeat

IPR000483 276 326 SM00082 Cysteine-rich flanking region

IPR003591 438 461 SM00369 Leucine-rich repeat

IPR003591 462 485 SM00369 Leucine-rich repeat

IPR003591 486 509 SM00369 Leucine-rich repeat

IPR003591 510 533 SM00369 Leucine-rich repeat

IPR003591 534 557 SM00369 Leucine-rich repeat

IPR003591 558 581 SM00369 Leucine-rich repeat

IPR000483 593 643 SM00082 Cysteine-rich flanking region

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	243	256	PR00019	Leucine-rich repeat
IPR001611	510	523	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	123	145	PF00560	Leucine-rich repeat
IPR001611	195	217	PF00560	Leucine-rich repeat
IPR001611	219	241	PF00560	Leucine-rich repeat
IPR001611	440	462	PF00560	Leucine-rich repeat
IPR001611	464	486	PF00560	Leucine-rich repeat
IPR001611	488	510	PF00560	Leucine-rich repeat
IPR001611	512	534	PF00560	Leucine-rich repeat
IPR001611	536	558	PF00560	Leucine-rich repeat
HMMSmart	IPR003591	145	168	SM00369	Leucine-rich repeat
IPR003591	169	192	SM00369	Leucine-rich repeat
IPR003591	193	216	SM00369	Leucine-rich repeat
IPR003591	217	240	SM00369	Leucine-rich repeat
IPR003591	244	264	SM00369	Leucine-rich repeat
IPR000483	276	326	SM00082	Cysteine-rich flanking region
IPR003591	438	461	SM00369	Leucine-rich repeat
IPR003591	462	485	SM00369	Leucine-rich repeat
IPR003591	486	509	SM00369	Leucine-rich repeat
IPR003591	510	533	SM00369	Leucine-rich repeat
IPR003591	534	557	SM00369	Leucine-rich repeat
IPR003591	558	581	SM00369	Leucine-rich repeat
IPR000483	593	643	SM00082	Cysteine-rich flanking region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 61 LALKMLLWILLLETSLCFAAGNV 83 PRIMARY 23

2 681 ISVLVPGLLLVFVTSAFTVVGML 703 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	61	LALKMLLWILLLETSLCFAAGNV	83	PRIMARY	23
2	681	ISVLVPGLLLVFVTSAFTVVGML	703	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GAGCTTTTCCTACGAGATAAC

Primer_r
: TCCAGGTAATTGCTATCCATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2211 bp
Genome contig ID	gi51511729r_83249342
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- ACACTTTTTTAATAAAATCTTTATTATAAACCATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTATTCCTAAGGCCATTCATCATTTTCTCTCTTGATTCTTTTGTTTGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	r	83349342	83354529	1	99.0	Perfect prediction

Primer_f	: GAGCTTTTCCTACGAGATAAC
Primer_r	: TCCAGGTAATTGCTATCCATG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1910

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information