HUGE

Gene/Protein Characteristic Table for KIAA1854

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06894
Accession No. :	AB058757
Description :	SLIT and NTRK-like protein 2 precursor.
HUGO Gene Name :	SLIT and NTRK-like family, member 2 (SLITRK2)
Clone Name :	fg02232 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5954 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 0 bp

Genome contig ID gi89161218f_144607381
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GGTGACTTGCGAATCTCCTGCTAAGCATGCAGGGG
Flanking genome sequence
(105955 - 106004)
----+----*----+----*----+----*----+----*----+----*
AGATACTAAAATTTCTGGGGAGGGAGGCTATCTGTCCAGACAGCCCAAAC

Features of the protein sequence	Description

Length: 572 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI41645	100.0	SLIT and NTRK-l...	Homo sapiens
BAC03566	100.0	unnamed protein...	Homo sapiens
AAQ89187	100.0	LSGV9197 [Homo ...	Homo sapiens
XP_001087022	100.0	similar to SLIT...	Macaca mulatta
Q9H156	100.0	SLIT and NTRK-l...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067497	2.6e-76	46.4	KIAA1910
AB020725	1.3e-48	56.9	KIAA0918
AB020655	4.8e-45	50.3	KIAA0848
AB011538	2.5e-12	26.8	KIAA0814
AB011537	2e-11	26.7	KIAA0813

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 189 202 PR00019 Leucine-rich repeat

IPR001611 428 441 PR00019 Leucine-rich repeat

HMMPfam IPR001611 93 115 PF00560 Leucine-rich repeat

IPR001611 117 139 PF00560 Leucine-rich repeat

IPR001611 141 163 PF00560 Leucine-rich repeat

IPR001611 165 187 PF00560 Leucine-rich repeat

IPR001611 188 208 PF00560 Leucine-rich repeat

IPR000372 345 378 PF01462 Leucine-rich repeat

IPR001611 406 428 PF00560 Leucine-rich repeat

IPR001611 430 452 PF00560 Leucine-rich repeat

IPR001611 454 476 PF00560 Leucine-rich repeat

IPR001611 478 500 PF00560 Leucine-rich repeat

IPR001611 501 523 PF00560 Leucine-rich repeat

HMMSmart IPR000372 34 70 SM00013 Leucine-rich repeat

IPR003591 95 114 SM00369 Leucine-rich repeat

IPR003591 115 138 SM00369 Leucine-rich repeat

IPR003591 139 162 SM00369 Leucine-rich repeat

IPR003591 163 186 SM00369 Leucine-rich repeat

IPR003591 187 210 SM00369 Leucine-rich repeat

IPR000483 222 270 SM00082 Cysteine-rich flanking region

IPR000372 345 382 SM00013 Leucine-rich repeat

IPR003591 404 427 SM00369 Leucine-rich repeat

IPR003591 428 451 SM00369 Leucine-rich repeat

IPR003591 452 475 SM00369 Leucine-rich repeat

IPR003591 476 499 SM00369 Leucine-rich repeat

IPR003591 500 523 SM00369 Leucine-rich repeat

IPR000483 535 572 SM00082 Cysteine-rich flanking region

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	189	202	PR00019	Leucine-rich repeat
IPR001611	428	441	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	93	115	PF00560	Leucine-rich repeat
IPR001611	117	139	PF00560	Leucine-rich repeat
IPR001611	141	163	PF00560	Leucine-rich repeat
IPR001611	165	187	PF00560	Leucine-rich repeat
IPR001611	188	208	PF00560	Leucine-rich repeat
IPR000372	345	378	PF01462	Leucine-rich repeat
IPR001611	406	428	PF00560	Leucine-rich repeat
IPR001611	430	452	PF00560	Leucine-rich repeat
IPR001611	454	476	PF00560	Leucine-rich repeat
IPR001611	478	500	PF00560	Leucine-rich repeat
IPR001611	501	523	PF00560	Leucine-rich repeat
HMMSmart	IPR000372	34	70	SM00013	Leucine-rich repeat
IPR003591	95	114	SM00369	Leucine-rich repeat
IPR003591	115	138	SM00369	Leucine-rich repeat
IPR003591	139	162	SM00369	Leucine-rich repeat
IPR003591	163	186	SM00369	Leucine-rich repeat
IPR003591	187	210	SM00369	Leucine-rich repeat
IPR000483	222	270	SM00082	Cysteine-rich flanking region
IPR000372	345	382	SM00013	Leucine-rich repeat
IPR003591	404	427	SM00369	Leucine-rich repeat
IPR003591	428	451	SM00369	Leucine-rich repeat
IPR003591	452	475	SM00369	Leucine-rich repeat
IPR003591	476	499	SM00369	Leucine-rich repeat
IPR003591	500	523	SM00369	Leucine-rich repeat
IPR000483	535	572	SM00082	Cysteine-rich flanking region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 4 CLKMLSGVWFLSVLTVAGILQTE 26 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	4	CLKMLSGVWFLSVLTVAGILQTE	26	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCTCTGACCTTTGATGCTTTG

Primer_r
: GGCAGGTGAGAAAAATGGTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	0 bp
Genome contig ID	gi89161218f_144607381
PolyA signal sequence (None)	+--------+--------+----*----+---- GGTGACTTGCGAATCTCCTGCTAAGCATGCAGGGG
Flanking genome sequence (105955 - 106004)	----+--------+--------+--------+--------+----* AGATACTAAAATTTCTGGGGAGGGAGGCTATCTGTCCAGACAGCCCAAAC

Primer_f	: CCTCTGACCTTTGATGCTTTG
Primer_r	: GGCAGGTGAGAAAAATGGTTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1854

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information