HUGE

Gene/Protein Characteristic Table for KIAA0918

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB020725
Description :	SLIT and NTRK-like protein 5 precursor.
HUGO Gene Name :	SLIT and NTRK-like family, member 5 (SLITRK5)
Clone Name :	hk09360 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4252 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 1348 bp

Genome contig ID gi51511729f_87025635
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AAATAGTTTCTGAATAAACACTTGATAACTATGTC
Flanking genome sequence
(104236 - 104285)
----+----*----+----*----+----*----+----*----+----*
AAATATGAGGGATGGAAGTAATGATTACTTAAGGTGCAAAAGACTTAACT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 f 87124645 87129869 2 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 966 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_522693	99.9	SLIT and NTRK-l...	Pan troglodytes
XP_001093404	99.7	similar to SLIT...	Macaca mulatta
O94991	100.0	SLIT and NTRK-l...	Homo sapiens
AAH98287	99.9	SLIT and NTRK-l...	Homo sapiens
XP_849372	98.3	similar to SLIT...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020655	9.7e-67	41.9	KIAA0848
AB058757	1.8e-31	57.0	KIAA1854
AB067497	3.7e-26	40.9	KIAA1910
AB040902	2.4e-07	29.6	KIAA1469
AB011538	1e-06	25.8	KIAA0814

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 210 223 PR00019 Leucine-rich repeat

IPR001611 464 477 PR00019 Leucine-rich repeat

HMMPfam IPR001611 138 160 PF00560 Leucine-rich repeat

IPR001611 162 184 PF00560 Leucine-rich repeat

IPR001611 209 229 PF00560 Leucine-rich repeat

IPR000372 381 414 PF01462 Leucine-rich repeat

IPR001611 442 464 PF00560 Leucine-rich repeat

IPR001611 466 488 PF00560 Leucine-rich repeat

IPR001611 490 512 PF00560 Leucine-rich repeat

IPR001611 514 536 PF00560 Leucine-rich repeat

IPR001611 537 557 PF00560 Leucine-rich repeat

HMMSmart IPR003591 116 135 SM00369 Leucine-rich repeat

IPR003591 136 159 SM00369 Leucine-rich repeat

IPR003591 160 183 SM00369 Leucine-rich repeat

IPR003591 184 207 SM00369 Leucine-rich repeat

IPR003591 210 231 SM00369 Leucine-rich repeat

IPR000483 243 293 SM00082 Cysteine-rich flanking region

IPR003591 441 463 SM00369 Leucine-rich repeat

IPR003591 464 487 SM00369 Leucine-rich repeat

IPR003591 488 511 SM00369 Leucine-rich repeat

IPR003591 512 535 SM00369 Leucine-rich repeat

IPR003591 536 559 SM00369 Leucine-rich repeat

IPR000483 571 621 SM00082 Cysteine-rich flanking region

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	210	223	PR00019	Leucine-rich repeat
IPR001611	464	477	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	138	160	PF00560	Leucine-rich repeat
IPR001611	162	184	PF00560	Leucine-rich repeat
IPR001611	209	229	PF00560	Leucine-rich repeat
IPR000372	381	414	PF01462	Leucine-rich repeat
IPR001611	442	464	PF00560	Leucine-rich repeat
IPR001611	466	488	PF00560	Leucine-rich repeat
IPR001611	490	512	PF00560	Leucine-rich repeat
IPR001611	514	536	PF00560	Leucine-rich repeat
IPR001611	537	557	PF00560	Leucine-rich repeat
HMMSmart	IPR003591	116	135	SM00369	Leucine-rich repeat
IPR003591	136	159	SM00369	Leucine-rich repeat
IPR003591	160	183	SM00369	Leucine-rich repeat
IPR003591	184	207	SM00369	Leucine-rich repeat
IPR003591	210	231	SM00369	Leucine-rich repeat
IPR000483	243	293	SM00082	Cysteine-rich flanking region
IPR003591	441	463	SM00369	Leucine-rich repeat
IPR003591	464	487	SM00369	Leucine-rich repeat
IPR003591	488	511	SM00369	Leucine-rich repeat
IPR003591	512	535	SM00369	Leucine-rich repeat
IPR003591	536	559	SM00369	Leucine-rich repeat
IPR000483	571	621	SM00082	Cysteine-rich flanking region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 672 SVLILSLLLVFIMSVFVAAGLFV 694 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	672	SVLILSLLLVFIMSVFVAAGLFV	694	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTGCATTTGTACAGATCCACG

Primer_r
: TCATCATTGCTTGCTGCCCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTGCATTTGTACAGATCCACG
Primer_r	: TCATCATTGCTTGCTGCCCAC
PCR product length	: 107 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	1348 bp
Genome contig ID	gi51511729f_87025635
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AAATAGTTTCTGAATAAACACTTGATAACTATGTC
Flanking genome sequence (104236 - 104285)	----+--------+--------+--------+--------+----* AAATATGAGGGATGGAAGTAATGATTACTTAAGGTGCAAAAGACTTAACT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	f	87124645	87129869	2	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0918

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information