HUGE |
Gene/Protein Characteristic Table for KIAA0806 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | |
---|---|
Accession No. : | AB018349 |
Description : | Leucine-rich repeats and immunoglobulin-like domains protein 2 precursor. |
HUGO Gene Name : | leucine-rich repeats and immunoglobulin-like domains 2 (LRIG2) |
Clone Name : | hk04165 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4203 bp
![]() |
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
cloned DNA seq. | ||
Warning for N-terminal truncation: | NO | NO |
Warning for coding interruption: | NO | NO |
Length of 3'UTR 619 bp Genome contig ID gi89161185f_113317354 PolyA signal sequence
(TATAAA,-7) +----*----+----*----+----*----+----
GGGATGTCATTGTAAATATATGTGCATTTATAAATFlanking genome sequence
(151513 - 151562) ----+----*----+----*----+----*----+----*----+----*
AATTTTTGTATTCATTGACCATATGTGTTGGCTGCAATGTAAATATTTTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 113417354 113468865 18 99.7 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1073 aa
This protein sequence is predicted from the revised DNA sequence
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001611 | 321 | 334 | PR00019 | Leucine-rich repeat |
IPR001611 | 366 | 379 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR001611 | 153 | 175 | PF00560 | Leucine-rich repeat |
IPR001611 | 176 | 198 | PF00560 | Leucine-rich repeat | |
IPR001611 | 224 | 246 | PF00560 | Leucine-rich repeat | |
IPR001611 | 248 | 270 | PF00560 | Leucine-rich repeat | |
IPR001611 | 272 | 294 | PF00560 | Leucine-rich repeat | |
IPR001611 | 320 | 342 | PF00560 | Leucine-rich repeat | |
IPR001611 | 344 | 366 | PF00560 | Leucine-rich repeat | |
IPR001611 | 395 | 417 | PF00560 | Leucine-rich repeat | |
IPR001611 | 419 | 441 | PF00560 | Leucine-rich repeat | |
IPR000483 | 476 | 501 | PF01463 | Cysteine-rich flanking region | |
IPR013151 | 520 | 590 | PF00047 | Immunoglobulin | |
IPR013098 | 610 | 700 | PF07679 | Immunoglobulin I-set | |
IPR013098 | 704 | 791 | PF07679 | Immunoglobulin I-set | |
HMMSmart | IPR003591 | 151 | 174 | SM00369 | Leucine-rich repeat |
IPR003591 | 176 | 197 | SM00369 | Leucine-rich repeat | |
IPR003591 | 222 | 245 | SM00369 | Leucine-rich repeat | |
NULL | 222 | 243 | SM00365 | NULL | |
IPR003591 | 246 | 269 | SM00369 | Leucine-rich repeat | |
IPR003591 | 270 | 293 | SM00369 | Leucine-rich repeat | |
NULL | 294 | 315 | SM00365 | NULL | |
IPR003591 | 294 | 317 | SM00369 | Leucine-rich repeat | |
IPR003591 | 318 | 341 | SM00369 | Leucine-rich repeat | |
NULL | 318 | 339 | SM00365 | NULL | |
IPR003591 | 342 | 365 | SM00369 | Leucine-rich repeat | |
IPR003591 | 366 | 392 | SM00369 | Leucine-rich repeat | |
NULL | 366 | 388 | SM00365 | NULL | |
IPR003591 | 393 | 416 | SM00369 | Leucine-rich repeat | |
NULL | 393 | 414 | SM00365 | NULL | |
IPR003591 | 417 | 440 | SM00369 | Leucine-rich repeat | |
NULL | 417 | 438 | SM00365 | NULL | |
IPR000483 | 451 | 501 | SM00082 | Cysteine-rich flanking region | |
IPR003599 | 512 | 607 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 518 | 595 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 616 | 701 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 622 | 690 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 710 | 792 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 716 | 781 | SM00408 | Immunoglobulin subtype 2 | |
ProfileScan | IPR007110 | 506 | 605 | PS50835 | Immunoglobulin-like |
IPR007110 | 610 | 699 | PS50835 | Immunoglobulin-like | |
IPR007110 | 704 | 793 | PS50835 | Immunoglobulin-like |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
SOSUI2 | 1 | 30 | SRLLFIAQTALLLLPAAGAGLCP | 52 | SECONDARY | 23 |
2 | 814 | VGIVIIVVVCCVVGTSLIWVIVI | 836 | PRIMARY | 23 |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TGCTTAACATGCTGGATTGCC | |
: CAACTATCTGCCTGAAACCAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 1 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |