HUGE

Gene/Protein Characteristic Table for KIAA0806

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB018349
Description :	Leucine-rich repeats and immunoglobulin-like domains protein 2 precursor.
HUGO Gene Name :	leucine-rich repeats and immunoglobulin-like domains 2 (LRIG2)
Clone Name :	hk04165 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4203 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO NO

Warning for coding interruption:
NO NO

Integrity of 3' end

Length of 3'UTR 619 bp

Genome contig ID gi89161185f_113317354
PolyA signal sequence
(TATAAA,-7)
+----*----+----*----+----*----+----
GGGATGTCATTGTAAATATATGTGCATTTATAAAT
Flanking genome sequence
(151513 - 151562)
----+----*----+----*----+----*----+----*----+----*
AATTTTTGTATTCATTGACCATATGTGTTGGCTGCAATGTAAATATTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 113417354 113468865 18 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1073 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O94898	100.0	Leucine-rich re...	Homo sapiens
BAF83720	99.9	unnamed protein...	Homo sapiens
XP_540333	91.9	similar to Leuc...	Canis lupus fam...
XP_001928200	92.8	similar to Leuc...	Sus scrofa
XP_001495377	92.5	similar to Leuc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046800	3e-17	29.3	KIAA1580
AB007876	4.7e-13	32.2	KIAA0416
AB020669	9.3e-13	27.2	KIAA0862
AB014544	1.7e-11	27.0	KIAA0644
AB002341	1.9e-11	28.9	KIAA0343

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 321 334 PR00019 Leucine-rich repeat

IPR001611 366 379 PR00019 Leucine-rich repeat

HMMPfam IPR001611 153 175 PF00560 Leucine-rich repeat

IPR001611 176 198 PF00560 Leucine-rich repeat

IPR001611 224 246 PF00560 Leucine-rich repeat

IPR001611 248 270 PF00560 Leucine-rich repeat

IPR001611 272 294 PF00560 Leucine-rich repeat

IPR001611 320 342 PF00560 Leucine-rich repeat

IPR001611 344 366 PF00560 Leucine-rich repeat

IPR001611 395 417 PF00560 Leucine-rich repeat

IPR001611 419 441 PF00560 Leucine-rich repeat

IPR000483 476 501 PF01463 Cysteine-rich flanking region

IPR013151 520 590 PF00047 Immunoglobulin

IPR013098 610 700 PF07679 Immunoglobulin I-set

IPR013098 704 791 PF07679 Immunoglobulin I-set

HMMSmart IPR003591 151 174 SM00369 Leucine-rich repeat

IPR003591 176 197 SM00369 Leucine-rich repeat

IPR003591 222 245 SM00369 Leucine-rich repeat

NULL 222 243 SM00365 NULL

IPR003591 246 269 SM00369 Leucine-rich repeat

IPR003591 270 293 SM00369 Leucine-rich repeat

NULL 294 315 SM00365 NULL

IPR003591 294 317 SM00369 Leucine-rich repeat

IPR003591 318 341 SM00369 Leucine-rich repeat

NULL 318 339 SM00365 NULL

IPR003591 342 365 SM00369 Leucine-rich repeat

IPR003591 366 392 SM00369 Leucine-rich repeat

NULL 366 388 SM00365 NULL

IPR003591 393 416 SM00369 Leucine-rich repeat

NULL 393 414 SM00365 NULL

IPR003591 417 440 SM00369 Leucine-rich repeat

NULL 417 438 SM00365 NULL

IPR000483 451 501 SM00082 Cysteine-rich flanking region

IPR003599 512 607 SM00409 Immunoglobulin subtype

IPR003598 518 595 SM00408 Immunoglobulin subtype 2

IPR003599 616 701 SM00409 Immunoglobulin subtype

IPR003598 622 690 SM00408 Immunoglobulin subtype 2

IPR003599 710 792 SM00409 Immunoglobulin subtype

IPR003598 716 781 SM00408 Immunoglobulin subtype 2

ProfileScan IPR007110 506 605 PS50835 Immunoglobulin-like

IPR007110 610 699 PS50835 Immunoglobulin-like

IPR007110 704 793 PS50835 Immunoglobulin-like

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	321	334	PR00019	Leucine-rich repeat
IPR001611	366	379	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	153	175	PF00560	Leucine-rich repeat
IPR001611	176	198	PF00560	Leucine-rich repeat
IPR001611	224	246	PF00560	Leucine-rich repeat
IPR001611	248	270	PF00560	Leucine-rich repeat
IPR001611	272	294	PF00560	Leucine-rich repeat
IPR001611	320	342	PF00560	Leucine-rich repeat
IPR001611	344	366	PF00560	Leucine-rich repeat
IPR001611	395	417	PF00560	Leucine-rich repeat
IPR001611	419	441	PF00560	Leucine-rich repeat
IPR000483	476	501	PF01463	Cysteine-rich flanking region
IPR013151	520	590	PF00047	Immunoglobulin
IPR013098	610	700	PF07679	Immunoglobulin I-set
IPR013098	704	791	PF07679	Immunoglobulin I-set
HMMSmart	IPR003591	151	174	SM00369	Leucine-rich repeat
IPR003591	176	197	SM00369	Leucine-rich repeat
IPR003591	222	245	SM00369	Leucine-rich repeat
NULL	222	243	SM00365	NULL
IPR003591	246	269	SM00369	Leucine-rich repeat
IPR003591	270	293	SM00369	Leucine-rich repeat
NULL	294	315	SM00365	NULL
IPR003591	294	317	SM00369	Leucine-rich repeat
IPR003591	318	341	SM00369	Leucine-rich repeat
NULL	318	339	SM00365	NULL
IPR003591	342	365	SM00369	Leucine-rich repeat
IPR003591	366	392	SM00369	Leucine-rich repeat
NULL	366	388	SM00365	NULL
IPR003591	393	416	SM00369	Leucine-rich repeat
NULL	393	414	SM00365	NULL
IPR003591	417	440	SM00369	Leucine-rich repeat
NULL	417	438	SM00365	NULL
IPR000483	451	501	SM00082	Cysteine-rich flanking region
IPR003599	512	607	SM00409	Immunoglobulin subtype
IPR003598	518	595	SM00408	Immunoglobulin subtype 2
IPR003599	616	701	SM00409	Immunoglobulin subtype
IPR003598	622	690	SM00408	Immunoglobulin subtype 2
IPR003599	710	792	SM00409	Immunoglobulin subtype
IPR003598	716	781	SM00408	Immunoglobulin subtype 2
ProfileScan	IPR007110	506	605	PS50835	Immunoglobulin-like
IPR007110	610	699	PS50835	Immunoglobulin-like
IPR007110	704	793	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 30 SRLLFIAQTALLLLPAAGAGLCP 52 SECONDARY 23

2 814 VGIVIIVVVCCVVGTSLIWVIVI 836 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	30	SRLLFIAQTALLLLPAAGAGLCP	52	SECONDARY	23
2	814	VGIVIIVVVCCVVGTSLIWVIVI	836	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGCTTAACATGCTGGATTGCC

Primer_r
: CAACTATCTGCCTGAAACCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	NO
Warning for coding interruption:	NO	NO

Length of 3'UTR	619 bp
Genome contig ID	gi89161185f_113317354
PolyA signal sequence (TATAAA,-7)	+--------+--------+----*----+---- GGGATGTCATTGTAAATATATGTGCATTTATAAAT
Flanking genome sequence (151513 - 151562)	----+--------+--------+--------+--------+----* AATTTTTGTATTCATTGACCATATGTGTTGGCTGCAATGTAAATATTTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	113417354	113468865	18	99.7	Perfect prediction

Primer_f	: TGCTTAACATGCTGGATTGCC
Primer_r	: CAACTATCTGCCTGAAACCAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0806

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information