HUGE

Gene/Protein Characteristic Table for KIAA1580

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00868
Accession No. :	AB046800
Description :	Netrin-G1 ligand precursor.
HUGO Gene Name :	leucine rich repeat containing 4C (LRRC4C)
Clone Name :	fj04979 [Vector Info]
Flexi ORF Clone :	pF1KSDA1580
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4055 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 167 bp

Genome contig ID gi51511727r_39992329
PolyA signal sequence
(ATTAAA,-31)
+----*----+----*----+----*----+----
ATTTATTAAAAATTCTATTGTGATCTAAAGCAGAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATTATGTGTATTCCTCAGAACCTGTTTTTGCTGCACTTATTCACTAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 40092329 40272240 2 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 640 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001488228	99.7	leucine rich re...	Equus caballus
Q8C031	99.7	Netrin-G1 ligan...	Mus musculus
XP_883747	99.7	similar to netr...	Bos taurus
BAC27884	99.5	unnamed protein...	Mus musculus
XP_540535	99.7	similar to netr...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018349	6.7e-19	29.8	KIAA0806
AB007865	1.7e-15	30.0	KIAA0405
D86983	5e-15	27.5	KIAA0230
AB040902	8.1e-15	30.1	KIAA1469
AB007876	8e-13	25.1	KIAA0416

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 221 234 PR00019 Leucine-rich repeat

IPR001611 266 279 PR00019 Leucine-rich repeat

HMMPfam IPR000372 46 75 PF01462 Leucine-rich repeat

IPR001611 77 99 PF00560 Leucine-rich repeat

IPR001611 101 123 PF00560 Leucine-rich repeat

IPR001611 125 147 PF00560 Leucine-rich repeat

IPR001611 149 171 PF00560 Leucine-rich repeat

IPR001611 198 218 PF00560 Leucine-rich repeat

IPR001611 220 242 PF00560 Leucine-rich repeat

IPR001611 268 290 PF00560 Leucine-rich repeat

IPR013098 354 443 PF07679 Immunoglobulin I-set

HMMSmart IPR000372 46 80 SM00013 Leucine-rich repeat

IPR003591 79 98 SM00369 Leucine-rich repeat

IPR003591 99 122 SM00369 Leucine-rich repeat

IPR003591 123 146 SM00369 Leucine-rich repeat

IPR003591 147 170 SM00369 Leucine-rich repeat

IPR003591 196 217 SM00369 Leucine-rich repeat

IPR003591 218 241 SM00369 Leucine-rich repeat

IPR003591 242 265 SM00369 Leucine-rich repeat

IPR003591 266 289 SM00369 Leucine-rich repeat

IPR003599 360 444 SM00409 Immunoglobulin subtype

IPR003598 366 433 SM00408 Immunoglobulin subtype 2

IPR003596 370 428 SM00406 Immunoglobulin V-set

ProfileScan IPR007110 354 442 PS50835 Immunoglobulin-like

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	221	234	PR00019	Leucine-rich repeat
IPR001611	266	279	PR00019	Leucine-rich repeat
HMMPfam	IPR000372	46	75	PF01462	Leucine-rich repeat
IPR001611	77	99	PF00560	Leucine-rich repeat
IPR001611	101	123	PF00560	Leucine-rich repeat
IPR001611	125	147	PF00560	Leucine-rich repeat
IPR001611	149	171	PF00560	Leucine-rich repeat
IPR001611	198	218	PF00560	Leucine-rich repeat
IPR001611	220	242	PF00560	Leucine-rich repeat
IPR001611	268	290	PF00560	Leucine-rich repeat
IPR013098	354	443	PF07679	Immunoglobulin I-set
HMMSmart	IPR000372	46	80	SM00013	Leucine-rich repeat
IPR003591	79	98	SM00369	Leucine-rich repeat
IPR003591	99	122	SM00369	Leucine-rich repeat
IPR003591	123	146	SM00369	Leucine-rich repeat
IPR003591	147	170	SM00369	Leucine-rich repeat
IPR003591	196	217	SM00369	Leucine-rich repeat
IPR003591	218	241	SM00369	Leucine-rich repeat
IPR003591	242	265	SM00369	Leucine-rich repeat
IPR003591	266	289	SM00369	Leucine-rich repeat
IPR003599	360	444	SM00409	Immunoglobulin subtype
IPR003598	366	433	SM00408	Immunoglobulin subtype 2
IPR003596	370	428	SM00406	Immunoglobulin V-set
ProfileScan	IPR007110	354	442	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 22 LFDPLLVVLLALQLLVVAGLVRA 44 PRIMARY 23

2 523 MKTTKIIIGCFVAITLMAAVMLV 545 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	22	LFDPLLVVLLALQLLVVAGLVRA	44	PRIMARY	23
2	523	MKTTKIIIGCFVAITLMAAVMLV	545	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AACGGAATGCCTTTGACAACC

Primer_r
: GTCACAGTTACAGTTCCAAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: RH-map
Primer_f	: AACGGAATGCCTTTGACAACC
Primer_r	: GTCACAGTTACAGTTCCAAGG
PCR product length	: 149 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	167 bp
Genome contig ID	gi51511727r_39992329
PolyA signal sequence (ATTAAA,-31)	+--------+--------+----*----+---- ATTTATTAAAAATTCTATTGTGATCTAAAGCAGAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATTATGTGTATTCCTCAGAACCTGTTTTTGCTGCACTTATTCACTAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	40092329	40272240	2	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA1580

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information