HUGE |
Gene/Protein Characteristic Table for KIAA1580 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00868 |
---|---|
Accession No. : | AB046800 |
Description : | Netrin-G1 ligand precursor. |
HUGO Gene Name : | leucine rich repeat containing 4C (LRRC4C) |
Clone Name : | fj04979 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1580 |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4055 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 167 bp Genome contig ID gi51511727r_39992329 PolyA signal sequence
(ATTAAA,-31) +----*----+----*----+----*----+----
ATTTATTAAAAATTCTATTGTGATCTAAAGCAGACFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAATTATGTGTATTCCTCAGAACCTGTTTTTGCTGCACTTATTCACTAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 r 40092329 40272240 2 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 640 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AACGGAATGCCTTTGACAACC | |
: GTCACAGTTACAGTTCCAAGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 11 |
: RH-map | |
: AACGGAATGCCTTTGACAACC | |
: GTCACAGTTACAGTTCCAAGG | |
: 149 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |