| HUGE |
Gene/Protein Characteristic Table for KIAA0231 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00037 |
|---|---|
| Accession No. : | D86984 |
| Description : | Leucine-rich repeat-containing protein 8B. |
| HUGO Gene Name : | leucine rich repeat containing 8 family, member B (LRRC8B) |
| Clone Name : | fk16230 [Vector Info] |
| Flexi ORF Clone : | pF1KA0231
![]() |
| Source : | Human fetal brain |
| Note : | We replaced ha02410, former representative clones for KIAA0231 with fk16230. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3615 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 333 bp Genome contig ID gi89161185f_89687489 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CACCAGCCTGGGTGACAGAGCAAGACTCTTATCTCFlanking genome sequence
(144037 - 144086) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAATGCTCCAGGGCTTTAAATGAGAAGTAAAATTTTC
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 89787489 89831524 6 99.7 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 823 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : |
| : | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |