HUGE

Gene/Protein Characteristic Table for KIAA1103

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07051
Accession No. :	AB029026
Description :	Transforming acidic coiled-coil-containing protein 1.
HUGO Gene Name :
Clone Name :	hk10190 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4117 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2753 bp

Genome contig ID gi51511724f_38697007
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GCACTCCATCCTGGGTGACAGCAAGATCTTGTCTC
Flanking genome sequence
(130445 - 130494)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAACCAGGAGTGAAAAAGGAAAGTAGAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 f 38797007 38827450 12 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 453 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001171527	9.9e-150	99.8	transforming, a...	Pan troglodytes
EAW63294	3.4e-125	99.5	transforming, a...	Homo sapiens
AAK68658	5.8e-116	99.5	gastric cancer ...	Homo sapiens
XP_001506072	7.6e-112	78.9	similar to TACC...	Ornithorhynchus...
XP_001171560	3.2e-111	99.4	transforming, a...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007707 245 451 PF05010 Transforming acidic coiled-coil-containing

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007707	245	451	PF05010	Transforming acidic coiled-coil-containing

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGACCCCTTAAGAACCTGACC

Primer_r
: GAGGAGGCATCTGTTAAGTTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGACCCCTTAAGAACCTGACC
Primer_r	: GAGGAGGCATCTGTTAAGTTC
PCR product length	: 146 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2753 bp
Genome contig ID	gi51511724f_38697007
PolyA signal sequence (None)	+--------+--------+----*----+---- GCACTCCATCCTGGGTGACAGCAAGATCTTGTCTC
Flanking genome sequence (130445 - 130494)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAACCAGGAGTGAAAAAGGAAAGTAGAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	f	38797007	38827450	12	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA1103

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information