HUGE

Gene/Protein Characteristic Table for KIAA1104

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB029027
Description :	Presequence protease, mitochondrial precursor.
HUGO Gene Name :	pitrilysin metallopeptidase 1 (PITRM1)
Clone Name :	fh00160 [Vector Info]
Flexi ORF Clone :	pF1KA1104
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5402 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 297 bp

Genome contig ID gi89161187r_3069926
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
AATATTTAAGAATCTAAAAATAAAGGGCAACTCTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTAACCTCTGCTTGAGTCATTATTTTAAGCAGCATTTAGGGCCTTTAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 3169926 3190279 17 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 636 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW86492	100.0	pitrilysin meta...	Homo sapiens
Q5JRX3	100.0	Presequence pro...	Homo sapiens
EAW86490	100.0	pitrilysin meta...	Homo sapiens
BAG57968	99.8	unnamed protein...	Homo sapiens
AAH05025	99.8	Pitrilysin meta...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013578 103 351 PF08367 Peptidase M16C associated

IPR007863 359 558 PF05193 Peptidase M16

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013578	103	351	PF08367	Peptidase M16C associated
IPR007863	359	558	PF05193	Peptidase M16

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGGACCACTTCTTGTACGGC

Primer_r
: TCAGCTCGGAGGTGTATTGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	297 bp
Genome contig ID	gi89161187r_3069926
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- AATATTTAAGAATCTAAAAATAAAGGGCAACTCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTAACCTCTGCTTGAGTCATTATTTTAAGCAGCATTTAGGGCCTTTAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	3169926	3190279	17	99.8	Perfect prediction

Primer_f	: ATGGACCACTTCTTGTACGGC
Primer_r	: TCAGCTCGGAGGTGTATTGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1104

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information