HUGE |
Gene/Protein Characteristic Table for KIAA1115 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK01151 |
---|---|
Accession No. : | AB029038 |
Description : | SAPS domain family member 1. |
HUGO Gene Name : | |
Clone Name : | hk05464 [Vector Info] |
Flexi ORF Clone : | pF1KA1115
![]() |
Source : | Human adult brain |
Note : | We replaced hk02303, former representative clones for KIAA1115 with hk05464. (2004/1/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3961 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 748 bp Genome contig ID gi42406306r_60332960 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
ATATTGCAAATATAAATAAAGGAAGGCAGTTTACGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATTCTGCTGGTCAGACCTTACGTTCTGGGATGCGGGGTGGGGAGCCTGTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 r 60432960 60462175 24 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 895 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 19 |
: GeneBridge 4 | |
: AAATCTTCCGTCCTCCCGTGG | |
: CTCTTCTCAGTGCAAATGGGG | |
: 167 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |