HUGE

Gene/Protein Characteristic Table for KIAA1558

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence

Product ID :	ORK01175
Accession No. :	AB046778
Description :	SAPS domain family member 3.
HUGO Gene Name :	SAPS domain family, member 3 (SAPS3)
Clone Name :	hj01607 [Vector Info]
Flexi ORF Clone :	pF1KA1558
Source :	Human adult brain
Note :	We replaced fh19035, former representative clones for KIAA1558 with hj01607. (2001/2/22)

Features of the cloned DNA sequence	Description

Length: 5059 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2204 bp

Genome contig ID gi51511727f_67884814
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
AATAACAAAAATAAAGCCTGATTCTTTGTTTCTAG
Flanking genome sequence
(254563 - 254612)
----+----*----+----*----+----*----+----*----+----*
AAATCTCTTGTACCTTGCTTGGATTTTTAATGGGTTGATGTGTCCTGCCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 f 67984814 68139375 24 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 882 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11337	100.0	SAPS domain fam...	synthetic construct
Q5H9R7	99.2	Serine/threonin...	Homo sapiens
XP_001173680	99.0	SAPS domain fam...	Pan troglodytes
CAI45957	99.0	hypothetical pr...	Homo sapiens
EAW74707	98.6	SAPS domain fam...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029038	4.3e-89	46.6	KIAA1115
AB014585	5.7e-74	46.4	KIAA0685

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007587 131 516 PF04499 SIT4 phosphatase-associated protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007587	131	516	PF04499	SIT4 phosphatase-associated protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2204 bp
Genome contig ID	gi51511727f_67884814
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- AATAACAAAAATAAAGCCTGATTCTTTGTTTCTAG
Flanking genome sequence (254563 - 254612)	----+--------+--------+--------+--------+----* AAATCTCTTGTACCTTGCTTGGATTTTTAATGGGTTGATGTGTCCTGCCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	f	67984814	68139375	24	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA1558

Features of the cloned DNA sequence

Features of the protein sequence