HUGE |
Gene/Protein Characteristic Table for KIAA1558 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | |
Product ID : | ORK01175 |
---|---|
Accession No. : | AB046778 |
Description : | SAPS domain family member 3. |
HUGO Gene Name : | SAPS domain family, member 3 (SAPS3) |
Clone Name : | hj01607 [Vector Info] |
Flexi ORF Clone : | pF1KA1558
![]() |
Source : | Human adult brain |
Note : | We replaced fh19035, former representative clones for KIAA1558 with hj01607. (2001/2/22) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5059 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2204 bp Genome contig ID gi51511727f_67884814 PolyA signal sequence
(AATAAA,-26) +----*----+----*----+----*----+----
AATAACAAAAATAAAGCCTGATTCTTTGTTTCTAGFlanking genome sequence
(254563 - 254612) ----+----*----+----*----+----*----+----*----+----*
AAATCTCTTGTACCTTGCTTGGATTTTTAATGGGTTGATGTGTCCTGCCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 f 67984814 68139375 24 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 882 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |