HUGE

Gene/Protein Characteristic Table for KIAA1121

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04421
Accession No. :	AB032947
Description :	Calcium-dependent secretion activator 1.
HUGO Gene Name :	Ca++-dependent secretion activator (CADPS)
Clone Name :	hh10147 [Vector Info]
Source :	Human adult brain
Note :	We replaced hj00332, former representative clones for KIAA1121 with hh10147. (2001/5/29)

Features of the cloned DNA sequence	Description

Length: 5471 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1059 bp

Genome contig ID gi89161205r_62259062
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
GCTTCTCAATAAATATTCAGATGTCCTAAGAATAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACGTTTGGGTCTGTCTTCCTCTGTCTACTTTGAATGCCAGAACTGAAACA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 62359062 62836094 29 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1390 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULU8	99.9	Calcium-depende...	Homo sapiens
XP_001174522	99.5	similar to muta...	Pan troglodytes
Q80TJ1	98.7	Calcium-depende...	Mus musculus
NP_001036082	98.7	Cadependent act...	Mus musculus
ABC61313	98.8	mutant Ca2+-dep...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046811	8.7e-102	75.8	KIAA1591

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000008 437 518 PF00168 C2 calcium-dependent membrane targeting

IPR001849 559 661 PF00169 Pleckstrin-like

IPR010439 872 977 PF06292 Protein of unknown function DUF1041

HMMSmart IPR001849 559 663 SM00233 Pleckstrin-like

ProfileScan IPR001849 558 661 PS50003 Pleckstrin-like

IPR014770 968 1148 PS51258 Munc13 homology 1

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	437	518	PF00168	C2 calcium-dependent membrane targeting
IPR001849	559	661	PF00169	Pleckstrin-like
IPR010439	872	977	PF06292	Protein of unknown function DUF1041
HMMSmart	IPR001849	559	663	SM00233	Pleckstrin-like
ProfileScan	IPR001849	558	661	PS50003	Pleckstrin-like
IPR014770	968	1148	PS51258	Munc13 homology 1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAAAATGAACCCCTTGTGTCG

Primer_r
: ACACAGTTGAGACGTAAAAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAAAATGAACCCCTTGTGTCG
Primer_r	: ACACAGTTGAGACGTAAAAGC
PCR product length	: 224 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1059 bp
Genome contig ID	gi89161205r_62259062
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- GCTTCTCAATAAATATTCAGATGTCCTAAGAATAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACGTTTGGGTCTGTCTTCCTCTGTCTACTTTGAATGCCAGAACTGAAACA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	62359062	62836094	29	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA1121

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information