HUGE

Gene/Protein Characteristic Table for KIAA1128

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05636
Accession No. :	AB032954
Description :	granule cell antiserum positive 14.
HUGO Gene Name :
Clone Name :	hg03213 [Vector Info]
Flexi ORF Clone :	pF1KA1128
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6737 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 4970 bp

Genome contig ID gi89161187f_86021527
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TTGGCATAGTAAATAAAAATAAAGTTCATAATTAT
Flanking genome sequence
(246724 - 246773)
----+----*----+----*----+----*----+----*----+----*
AAAAGTTCTCTTGTCTTTCTCAACATTGACTCCCATAGTTTGCTTTTTCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 86121527 86268249 10 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 588 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001155270	0	99.2	granule cell an...	Pan troglodytes
XP_001085630	0	98.0	similar to gran...	Macaca mulatta
AAG44473	0	100.0	NPD012 [Homo sa...	Homo sapiens
XP_507884	0	99.5	granule cell an...	Pan troglodytes
XP_001927867	5.8e-216	92.5	similar to Prot...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051467	0.00072	25.7	KIAA1680

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCCAACATTTTCAGGAGAGAC

Primer_r
: AGCTTACCCACTTTCTCCTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	4970 bp
Genome contig ID	gi89161187f_86021527
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TTGGCATAGTAAATAAAAATAAAGTTCATAATTAT
Flanking genome sequence (246724 - 246773)	----+--------+--------+--------+--------+----* AAAAGTTCTCTTGTCTTTCTCAACATTGACTCCCATAGTTTGCTTTTTCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	86121527	86268249	10	99.2	Perfect prediction

Primer_f	: GCCAACATTTTCAGGAGAGAC
Primer_r	: AGCTTACCCACTTTCTCCTTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1128

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information