HUGE |
Gene/Protein Characteristic Table for KIAA1133 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00746 |
---|---|
Accession No. : | AB051436 |
Description : | Zinc/RING finger protein 3 precursor. |
HUGO Gene Name : | zinc and ring finger 3 (ZNRF3) |
Clone Name : | hg03758b [Vector Info] |
Flexi ORF Clone : | pF1KSDA1133
![]() |
Source : | Human adult brain |
Note : | We replaced hh04035, former representative clones for KIAA1133 with hg03758b. (2001/5/29) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6542 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3866 bp Genome contig ID gi89161203f_27509890 PolyA signal sequence
(AATACA,-25) +----*----+----*----+----*----+----
GTAAAAAAAAAATACAATTTTATCAAGTATGTGTTFlanking genome sequence
(273587 - 273636) ----+----*----+----*----+----*----+----*----+----*
ATATGTTGTCATTGGTCTGTTCAGTAAAAGTCTGCAGATTCAACAAGGGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 f 27609890 27783475 9 99.1 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 891 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ACAGCCATATACAGTGAAGAG | |
: TAAGTATGTGAGCAGTGGGAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 22 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |