HUGE

Gene/Protein Characteristic Table for KIAA1214

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00768
Accession No. :	AB033040
Description :	RING finger protein 150 precursor.
HUGO Gene Name :	ring finger protein 150 (RNF150)
Clone Name :	fh01431 [Vector Info]
Flexi ORF Clone :	pF1KSDA1214
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5111 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3266 bp

Genome contig ID gi89161207r_141906175
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GTTTCTGGAGGATTTTCCTGTAGCTTTGATAGTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAGAAAAAAAAAAAGCTTAACCAGAAAGTTTCTCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 r 142006175 142274066 8 100.0 Internal No-hit

Features of the protein sequence	Description

Length: 462 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX05090	8.1e-150	100.0	ring finger pro...	Homo sapiens
Q9ULK6	2.3e-72	90.4	RING finger pro...	Homo sapiens
BAC85369	4.9e-69	84.5	unnamed protein...	Homo sapiens
XP_001502278	6.5e-67	87.5	ring finger pro...	Equus caballus
XP_871924	1.3e-66	78.6	similar to RING...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051436	1.7e-07	26.1	KIAA1133
AB029023	1.4e-05	34.4	KIAA1100
AB014575	0.00028	38.9	KIAA0675
AB007898	0.00049	31.4	KIAA0438
AB058713	0.00066	28.6	KIAA1810

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003137 147 249 PF02225 Protease-associated PA

IPR001841 302 342 PF00097 Zinc finger

HMMSmart IPR001841 302 342 SM00184 Zinc finger

ProfileScan IPR001841 302 343 PS50089 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003137	147	249	PF02225	Protease-associated PA
IPR001841	302	342	PF00097	Zinc finger
HMMSmart	IPR001841	302	342	SM00184	Zinc finger
ProfileScan	IPR001841	302	343	PS50089	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 72 IQACCSLALSTWLLSFCFVHLLC 94 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	72	IQACCSLALSTWLLSFCFVHLLC	94	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCAAGAACTAGGTGAATCAGG

Primer_r
: AGTAGTGAATGGCAAAGGCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3266 bp
Genome contig ID	gi89161207r_141906175
PolyA signal sequence (None)	+--------+--------+----*----+---- GTTTCTGGAGGATTTTCCTGTAGCTTTGATAGTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAGAAAAAAAAAAAGCTTAACCAGAAAGTTTCTCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	r	142006175	142274066	8	100.0	Internal No-hit

Primer_f	: CCAAGAACTAGGTGAATCAGG
Primer_r	: AGTAGTGAATGGCAAAGGCTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1214

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information