HUGE

Gene/Protein Characteristic Table for KIAA1143

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05637
Accession No. :	AB032969
Description :
HUGO Gene Name :
Clone Name :	hj00512 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4946 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4595 bp

Genome contig ID gi89161205r_44665351
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GGCCTACTAAGTGCACAATAAACATAGTTAAAATG
Flanking genome sequence
(99891 - 99842)
----+----*----+----*----+----*----+----*----+----*
AATGAGAGTGTTGTCTGTAATTTTCTTTTTATAGATGAGTAGGTCTCATG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 44765242 44770858 2 99.0 Perfect prediction

ContigView(URL based/DAS) 14 r 31806223 31811162 1 98.0 Perfect prediction

Features of the protein sequence	Description

Length: 116 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW65934	1.5e-39	98.3	hCG1639915 [Hom...	Homo sapiens
XP_001105000	1.2e-38	96.6	similar to T25G...	Macaca mulatta
BAB23258	9.3e-33	86.3	unnamed protein...	Mus musculus
XP_533861	1.8e-32	88.7	similar to T25G...	Canis lupus fam...
NP_001016005	3.1e-19	60.0	hypothetical pr...	Xenopus (Silura...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGTGGATGAGCTAGGAAGACC

Primer_r
: CCCACACCCAGATACTAAGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGTGGATGAGCTAGGAAGACC
Primer_r	: CCCACACCCAGATACTAAGAC
PCR product length	: 215 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4595 bp
Genome contig ID	gi89161205r_44665351
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GGCCTACTAAGTGCACAATAAACATAGTTAAAATG
Flanking genome sequence (99891 - 99842)	----+--------+--------+--------+--------+----* AATGAGAGTGTTGTCTGTAATTTTCTTTTTATAGATGAGTAGGTCTCATG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	44765242	44770858	2	99.0	Perfect prediction
ContigView(URL based/DAS)	14	r	31806223	31811162	1	98.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1143

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information