HUGE

Gene/Protein Characteristic Table for KIAA1154

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00190
Accession No. :	AB032980
Description :	Doublecortin domain-containing protein 2.
HUGO Gene Name :	doublecortin domain containing 2 (DCDC2)
Clone Name :	hh03679s1 [Vector Info]
Flexi ORF Clone :	pF1KA1154
Source :	Human adult brain
Note :	We replaced hh03679, former representative clones for KIAA1154 with hh03679s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6548 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5117 bp

Genome contig ID gi89161210r_24178103
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCCTGGGCGACAGAGCGAGACTCCGTCTC
Flanking genome sequence
(99719 - 99670)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAGAATGTCTCTTTAAGGAAAATTATTTGTATTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 24277822 24465957 10 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 476 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UHG0	2e-166	99.8	Doublecortin do...	Homo sapiens
AAH50704	2.3e-166	99.8	DCDC2 protein [...	Homo sapiens
XP_001100219	3.7e-160	95.2	doublecortin do...	Macaca mulatta
XP_001495221	2.3e-150	89.3	similar to RU2S...	Equus caballus
XP_001928023	3.6e-148	88.7	similar to RU2S...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002367	3.1e-10	30.6	KIAA0369

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003533 34 95 PF03607 Doublecortin

IPR003533 156 216 PF03607 Doublecortin

HMMSmart IPR003533 12 100 SM00537 Doublecortin

IPR003533 134 221 SM00537 Doublecortin

ProfileScan IPR003533 17 100 PS50309 Doublecortin

IPR003533 139 221 PS50309 Doublecortin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003533	34	95	PF03607	Doublecortin
IPR003533	156	216	PF03607	Doublecortin
HMMSmart	IPR003533	12	100	SM00537	Doublecortin
IPR003533	134	221	SM00537	Doublecortin
ProfileScan	IPR003533	17	100	PS50309	Doublecortin
IPR003533	139	221	PS50309	Doublecortin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTAGGTTGCCACACTCATAGG

Primer_r
: ACTCTGAACCACGTATGTATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5117 bp
Genome contig ID	gi89161210r_24178103
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGCGACAGAGCGAGACTCCGTCTC
Flanking genome sequence (99719 - 99670)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAGAATGTCTCTTTAAGGAAAATTATTTGTATTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	24277822	24465957	10	99.2	Perfect prediction

Primer_f	: TTAGGTTGCCACACTCATAGG
Primer_r	: ACTCTGAACCACGTATGTATG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1154

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information