HUGE |
Gene/Protein Characteristic Table for KIAA0369 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04711 |
---|---|
Accession No. : | AB002367 |
Description : | Serine/threonine-protein kinase DCLK1. |
HUGO Gene Name : | doublecortin-like kinase 1 (DCLK1) |
Clone Name : | hh00177 [Vector Info] |
Flexi ORF Clone : | pF1KA0369 |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5703 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Features of the protein sequence |
Description | |
---|---|---|
Length: 794 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: ACGTGTAAGTTAGATGAGGGC | |
: GCATCGTGTAAATCATCTCTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 13 |
: GeneBridge 4 | |
: ACGTGTAAGTTAGATGAGGGC | |
: GCATCGTGTAAATCATCTCTG | |
: 189 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |