HUGE

Gene/Protein Characteristic Table for KIAA0968

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00158
Accession No. :	AB023185
Description :	Calcium/calmodulin-dependent protein kinase type II alpha chain.
HUGO Gene Name :	calcium/calmodulin-dependent protein kinase II alpha (CAMK2A)
Clone Name :	hj06483 [Vector Info]
Flexi ORF Clone :	pF1KA0968
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4797 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3212 bp

Genome contig ID gi51511721r_149479253
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TGGTGTTTTCAGTGCAATAAATAGCTACAAACTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TGTGCACTCTGTGTGTCCCTGTCTTGGTCAAGCCCCTGAGCTGGGAGGTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 r 149579253 149649529 18 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 527 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q5RCC4	5e-198	100.0	Calcium/calmodu...	Pongo abelii
CAI65266	8e-198	96.4	EGFP-CaMKII fus...	Cloning vector ...
P11275	9e-198	99.8	Calcium/calmodu...	Rattus norvegicus
AAX22059	1e-197	99.2	Camuialpha [syn...	synthetic construct
AAH40457	1e-197	99.8	Calcium/calmodu...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002367	1.2e-40	38.9	KIAA0369
AB051552	1.3e-39	39.7	KIAA1765
AB058763	1.6e-31	35.2	KIAA1860
D43636	1.8e-30	37.9	KIAA0096
AB023216	6.1e-30	32.0	KIAA0999

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 62 319 PD000001 Protein kinase

HMMPfam IPR000719 62 320 PF00069 Protein kinase

IPR013543 395 522 PF08332 Calcium/calmodulin dependent protein kinase II

HMMSmart IPR001245 62 320 SM00219 Tyrosine protein kinase

IPR002290 62 320 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 62 320 PS50011 Protein kinase

ScanRegExp IPR000719 68 91 PS00107 Protein kinase

IPR008271 180 192 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	62	319	PD000001	Protein kinase
HMMPfam	IPR000719	62	320	PF00069	Protein kinase
IPR013543	395	522	PF08332	Calcium/calmodulin dependent protein kinase II
HMMSmart	IPR001245	62	320	SM00219	Tyrosine protein kinase
IPR002290	62	320	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	62	320	PS50011	Protein kinase
ScanRegExp	IPR000719	68	91	PS00107	Protein kinase
IPR008271	180	192	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 243 VDLWACGVILYILLVGYPPFWDE 265 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	243	VDLWACGVILYILLVGYPPFWDE	265	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCAGCCTCAGTTCCCTCATTG

Primer_r
: AGAAGTAAACAGGAGTCCAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3212 bp
Genome contig ID	gi51511721r_149479253
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TGGTGTTTTCAGTGCAATAAATAGCTACAAACTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGTGCACTCTGTGTGTCCCTGTCTTGGTCAAGCCCCTGAGCTGGGAGGTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	r	149579253	149649529	18	99.3	Perfect prediction

Primer_f	: TCAGCCTCAGTTCCCTCATTG
Primer_r	: AGAAGTAAACAGGAGTCCAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0968

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information