HUGE

Gene/Protein Characteristic Table for KIAA0096

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00407
Accession No. :	D43636
Description :	SNF-related serine/threonine-protein kinase.
HUGO Gene Name :	SNF related kinase (SNRK)
Clone Name :	ha01240s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0096
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha01240, former representative clones for KIAA0096 with ha01240s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4882 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2580 bp

Genome contig ID gi89161205f_43219696
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
CCAAATAATAAAGTGACATATTGGTGTTCAGCAAT
Flanking genome sequence
(147940 - 147989)
----+----*----+----*----+----*----+----*----+----*
ATAAACCGTGTCCTGTGTTGTATTGCTTCTCATGAGTGTAGCTTTGTGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 43319696 43367634 5 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 766 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NRH2	100.0	SNF-related ser...	Homo sapiens
AAH71567	99.6	SNRK protein [H...	Homo sapiens
XP_516395	99.6	SNF related kin...	Pan troglodytes
AAF86944	99.7	HSNFRK [Homo sa...	Homo sapiens
BAF84049	99.7	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018324	5.4e-30	34.4	KIAA0781
AB023216	2.7e-29	38.0	KIAA0999
AB058763	7e-29	32.6	KIAA1860
D79997	5.1e-23	36.5	KIAA0175
AB011109	1.5e-19	28.6	KIAA0537

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 17 269 PD000001 Protein kinase

HMMPfam IPR000719 17 270 PF00069 Protein kinase

IPR000449 295 335 PF00627 Ubiquitin-associated/Translation elongation factor EF1B

HMMSmart IPR001245 17 270 SM00219 Tyrosine protein kinase

IPR002290 17 270 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 17 270 PS50011 Protein kinase

IPR000449 292 335 PS50030 Ubiquitin-associated/Translation elongation factor EF1B

ScanRegExp IPR000719 23 46 PS00107 Protein kinase

IPR008271 136 148 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	17	269	PD000001	Protein kinase
HMMPfam	IPR000719	17	270	PF00069	Protein kinase
IPR000449	295	335	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
HMMSmart	IPR001245	17	270	SM00219	Tyrosine protein kinase
IPR002290	17	270	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	17	270	PS50011	Protein kinase
IPR000449	292	335	PS50030	Ubiquitin-associated/Translation elongation factor EF1B
ScanRegExp	IPR000719	23	46	PS00107	Protein kinase
IPR008271	136	148	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CTAATTACACGGATGCTACAG
Primer_r	: AATGATGCTGTTGTGCTCCTC
PCR product length	: 165 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2580 bp
Genome contig ID	gi89161205f_43219696
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- CCAAATAATAAAGTGACATATTGGTGTTCAGCAAT
Flanking genome sequence (147940 - 147989)	----+--------+--------+--------+--------+----* ATAAACCGTGTCCTGTGTTGTATTGCTTCTCATGAGTGTAGCTTTGTGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	43319696	43367634	5	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0096

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information