HUGE |
Gene/Protein Characteristic Table for KIAA0096 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00407 |
---|---|
Accession No. : | D43636 |
Description : | SNF-related serine/threonine-protein kinase. |
HUGO Gene Name : | SNF related kinase (SNRK) |
Clone Name : | ha01240s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0096
![]() |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced ha01240, former representative clones for KIAA0096 with ha01240s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4882 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2580 bp Genome contig ID gi89161205f_43219696 PolyA signal sequence
(AATAAA,-29) +----*----+----*----+----*----+----
CCAAATAATAAAGTGACATATTGGTGTTCAGCAATFlanking genome sequence
(147940 - 147989) ----+----*----+----*----+----*----+----*----+----*
ATAAACCGTGTCCTGTGTTGTATTGCTTCTCATGAGTGTAGCTTTGTGTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 f 43319696 43367634 5 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 766 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 3 |
: Genebridge 4 | |
: CTAATTACACGGATGCTACAG | |
: AATGATGCTGTTGTGCTCCTC | |
: 165 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |