HUGE |
Gene/Protein Characteristic Table for KIAA0175 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05968 |
---|---|
Accession No. : | D79997 |
Description : | Maternal embryonic leucine zipper kinase. |
HUGO Gene Name : | maternal embryonic leucine zipper kinase (MELK) |
Clone Name : | ha02337 [Vector Info] |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2470 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 344 bp Genome contig ID gi89161216f_36462873 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
TAATTTCTTTCTGAAATAAAACCATTTGTGAATATFlanking genome sequence
(204807 - 204856) ----+----*----+----*----+----*----+----*----+----*
AGCAGGCTTCTCTTTTTTGTATTTGATTTTGATCCAAATAAAACCTCAAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 9 f 36562873 36667678 18 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 656 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 9 |
: Genebridge 4 | |
: GGATGAGTGTGGGTGTGATAC | |
: TGACAGATGGGCTTGATTTAG | |
: 173 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |