HUGE

Gene/Protein Characteristic Table for KIAA0537

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00556
Accession No. :	AB011109
Description :	NUAK family SNF1-like kinase 1.
HUGO Gene Name :	NUAK family, SNF1-like kinase, 1 (NUAK1)
Clone Name :	hg03925 [Vector Info]
Flexi ORF Clone :	pF1KSDA0537
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6828 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 698 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60285	100.0	NUAK family SNF...	Homo sapiens
XP_001161041	99.7	AMPK-related pr...	Pan troglodytes
XP_001098986	97.9	AMPK-related pr...	Macaca mulatta
XP_001789835	94.3	similar to NUAK...	Bos taurus
EDL21399	89.6	ZNUAK family, S...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058763	7.4e-32	33.3	KIAA1860
AB023216	1.2e-30	37.8	KIAA0999
AB018324	1e-26	42.4	KIAA0781
D79997	7.4e-24	31.1	KIAA0175
AB058714	1.5e-22	29.2	KIAA1811

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 92 342 PD000001 Protein kinase

HMMPfam IPR000719 92 343 PF00069 Protein kinase

HMMSmart IPR001245 92 341 SM00219 Tyrosine protein kinase

IPR002290 92 343 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 92 343 PS50011 Protein kinase

ScanRegExp IPR000719 98 125 PS00107 Protein kinase

IPR008271 211 223 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	92	342	PD000001	Protein kinase
HMMPfam	IPR000719	92	343	PF00069	Protein kinase
HMMSmart	IPR001245	92	341	SM00219	Tyrosine protein kinase
IPR002290	92	343	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	92	343	PS50011	Protein kinase
ScanRegExp	IPR000719	98	125	PS00107	Protein kinase
IPR008271	211	223	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: ATGCTAAGTACCCTCTGAATG

Primer_r
: GCAACAAGCAGTCAGTCGATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATGCTAAGTACCCTCTGAATG
Primer_r	: GCAACAAGCAGTCAGTCGATC
PCR product length	: 150 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0537

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information