HUGE

Gene/Protein Characteristic Table for KIAA0781

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00636
Accession No. :	AB018324
Description :	Serine/threonine-protein kinase SNF1-like kinase 2.
HUGO Gene Name :	SNF1-like kinase 2 (SNF1LK2)
Clone Name :	hk09678 [Vector Info]
Flexi ORF Clone :	pF1KSDA0781
Source :	Human adult brain
Note :	We replaced hk05370 and fj04126, former representative clones for KIAA0781 with hk09678. (2001/5/29,2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4160 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1305 bp

Genome contig ID gi51511727f_110878424
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
CATTATATTACTAATAAAACTTAACCAACACTTAC
Flanking genome sequence
(222946 - 222995)
----+----*----+----*----+----*----+----*----+----*
AATTCAGTCATCAAAGTAAGTAAAAATTAGATGCTACAGCTAGCTAACTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 f 110978424 111101368 15 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 950 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9H0K1	100.0	Serine/threonin...	Homo sapiens
BAF83922	99.8	unnamed protein...	Homo sapiens
Q5REX1	98.9	Serine/threonin...	Pongo abelii
XP_508750	99.8	hypothetical pr...	Pan troglodytes
XP_001500093	93.6	SNF1-like kinas...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023216	4.8e-28	36.7	KIAA0999
AB058763	4.9e-20	55.8	KIAA1860
D43636	3.3e-15	34.2	KIAA0096
AB040910	9.6e-14	50.6	KIAA1477
AB058714	1.3e-13	30.8	KIAA1811

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 49 295 PD000001 Protein kinase

HMMPfam IPR000719 44 295 PF00069 Protein kinase

HMMSmart IPR001245 44 295 SM00219 Tyrosine protein kinase

IPR002290 44 295 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 44 295 PS50011 Protein kinase

IPR000449 319 359 PS50030 Ubiquitin-associated/Translation elongation factor EF1B

ScanRegExp IPR000719 50 73 PS00107 Protein kinase

IPR008271 162 174 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	49	295	PD000001	Protein kinase
HMMPfam	IPR000719	44	295	PF00069	Protein kinase
HMMSmart	IPR001245	44	295	SM00219	Tyrosine protein kinase
IPR002290	44	295	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	44	295	PS50011	Protein kinase
IPR000449	319	359	PS50030	Ubiquitin-associated/Translation elongation factor EF1B
ScanRegExp	IPR000719	50	73	PS00107	Protein kinase
IPR008271	162	174	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 222 LDIWSMGVVLYVLVCGALPFDGP 244 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	222	LDIWSMGVVLYVLVCGALPFDGP	244	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCTTATTCTCCACTCAACAGC

Primer_r
: TAGACATCTTTGAGGTGAGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1305 bp
Genome contig ID	gi51511727f_110878424
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CATTATATTACTAATAAAACTTAACCAACACTTAC
Flanking genome sequence (222946 - 222995)	----+--------+--------+--------+--------+----* AATTCAGTCATCAAAGTAAGTAAAAATTAGATGCTACAGCTAGCTAACTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	f	110978424	111101368	15	99.5	Perfect prediction

Primer_f	: CCTTATTCTCCACTCAACAGC
Primer_r	: TAGACATCTTTGAGGTGAGCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0781

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information