HUGE

Gene/Protein Characteristic Table for KIAA1811

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04289
Accession No. :	AB058714
Description :	BR serine/threonine-protein kinase 1.
HUGO Gene Name :	BR serine/threonine kinase 1 (BRSK1)
Clone Name :	ha06731 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 2576 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 427 bp

Genome contig ID gi42406306f_60390239
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GATTTGCTCTCCGGAAGGAATTCTGGTTTCGCGTG
Flanking genome sequence
(125438 - 125487)
----+----*----+----*----+----*----+----*----+----*
ATCCTGCCTGCGTCCGTGTCTCTGATTCCGCCGGCGGCAAAAAAAAAAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 60490239 60515675 18 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 715 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAD38950	9e-197	100.0	hypothetical pr...	Homo sapiens
AAL87698	9.2e-197	100.0	protein kinase-...	Homo sapiens
Q8TDC3	9.4e-197	100.0	BR serine/threo...	Homo sapiens
XP_001489769	2.2e-195	99.3	BR serine/threo...	Equus caballus
AAT08446	3e-195	99.3	putative serine...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023216	1.4e-16	36.5	KIAA0999
AB058763	5e-16	35.5	KIAA1860
AB018324	8.9e-16	31.0	KIAA0781
D79997	5.3e-12	37.5	KIAA0175
AB040910	5.4e-12	32.3	KIAA1477

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 1 221 PD000001 Protein kinase

HMMPfam IPR000719 1 222 PF00069 Protein kinase

HMMSmart IPR001245 1 223 SM00219 Tyrosine protein kinase

IPR002290 1 222 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 1 222 PS50011 Protein kinase

IPR000449 251 293 PS50030 Ubiquitin-associated/Translation elongation factor EF1B

ScanRegExp IPR008271 89 101 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	1	221	PD000001	Protein kinase
HMMPfam	IPR000719	1	222	PF00069	Protein kinase
HMMSmart	IPR001245	1	223	SM00219	Tyrosine protein kinase
IPR002290	1	222	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	1	222	PS50011	Protein kinase
IPR000449	251	293	PS50030	Ubiquitin-associated/Translation elongation factor EF1B
ScanRegExp	IPR008271	89	101	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 152 WSCGVILFALLVGALPFDDDNLR 174 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	152	WSCGVILFALLVGALPFDDDNLR	174	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCTCAACTCCATCCGCAACAG

Primer_r
: GATGCTGCTGAGAGGTTTGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	427 bp
Genome contig ID	gi42406306f_60390239
PolyA signal sequence (None)	+--------+--------+----*----+---- GATTTGCTCTCCGGAAGGAATTCTGGTTTCGCGTG
Flanking genome sequence (125438 - 125487)	----+--------+--------+--------+--------+----* ATCCTGCCTGCGTCCGTGTCTCTGATTCCGCCGGCGGCAAAAAAAAAAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	60490239	60515675	18	100.0	Perfect prediction

Primer_f	: TCTCAACTCCATCCGCAACAG
Primer_r	: GATGCTGCTGAGAGGTTTGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1811

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information