HUGE |
Gene/Protein Characteristic Table for KIAA1161 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK00192 |
---|---|
Accession No. : | AB032987 |
Description : | |
HUGO Gene Name : | |
Clone Name : | hj01210s1 [Vector Info] |
Flexi ORF Clone : | pF1KA1161
![]() |
Source : | Human adult brain |
Note : | We replaced hj01210, former representative clones for KIAA1161 with hj01210s1. (2003/4/2) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5839 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Features of the protein sequence |
Description | |
---|---|---|
Length: 680 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 9 |
: GeneBridge 4 | |
: CGGCCATGCAGTTCTCTATCC | |
: AGTCGATACGGTGAGCTGTCT | |
: 201 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |