HUGE |
Gene/Protein Characteristic Table for KIAA0088 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00404 |
---|---|
Accession No. : | D42041 |
Description : | Neutral alpha-glucosidase AB precursor. |
HUGO Gene Name : | glucosidase, alpha; neutral AB (GANAB) |
Clone Name : | ha01225 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0088 |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3820 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 987 bp Genome contig ID gi51511727r_62048876 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
TCAAAGGAGAAACAATAAAGGGATAAACCATAAATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AACTGGTGGTAGTCTGGATTCTAGTTCTAGCCTGAGCCACAGACCCTAGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 r 62148876 62170645 24 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 943 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 8 |
: Genebridge 4 | |
: TTACTCCCCTTTTTATGCCCC | |
: ACAAGAAGGGGGCAAAAGAAG | |
: 251 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |