HUGE

Gene/Protein Characteristic Table for KIAA1162

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07256
Accession No. :	AB032988
Description :	Thioredoxin domain-containing protein 13 precursor.
HUGO Gene Name :	thioredoxin domain containing 13 (TXNDC13)
Clone Name :	hj05107 [Vector Info]
Flexi ORF Clone :	pF1KA1162
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5224 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4875 bp

Genome contig ID gi51511747r_7806024
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CCATTTGCCTAGGCAGCAAAAAATATTAATTTGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAATTTTCCTTCGTGTCCATCCTCCATCTAGTCTGTTCATTCATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 7906024 7911246 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 115 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAB56344	6e-34	100.0	hypothetical pr...	Homo sapiens
XP_001167731	8.7e-34	100.0	thioredoxin dom...	Pan troglodytes
Q9H1E5	9.3e-34	100.0	Thioredoxin dom...	Homo sapiens
BAC11237	2.6e-33	99.1	unnamed protein...	Homo sapiens
AAH33787	3.8e-33	99.1	Thioredoxin dom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AACATACAGGCAATCCACATC

Primer_r
: AATGTATAGAGCTAAAGAGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4875 bp
Genome contig ID	gi51511747r_7806024
PolyA signal sequence (None)	+--------+--------+----*----+---- CCATTTGCCTAGGCAGCAAAAAATATTAATTTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAATTTTCCTTCGTGTCCATCCTCCATCTAGTCTGTTCATTCATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	7906024	7911246	1	99.0	Perfect prediction

Primer_f	: AACATACAGGCAATCCACATC
Primer_r	: AATGTATAGAGCTAAAGAGGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1162

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information