HUGE |
Gene/Protein Characteristic Table for KIAA1164 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04977 |
---|---|
Accession No. : | AB032990 |
Description : | family with sequence similarity 63, member B (FAM63B), transcript variant 1, mRNA. |
HUGO Gene Name : | family with sequence similarity 63, member B (FAM63B) |
Clone Name : | hk00541 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4097 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2923 bp Genome contig ID gi51511731f_56751576 PolyA signal sequence
(AATAGA,-21) +----*----+----*----+----*----+----
ATGCAAGCCTGGGCAATAGAGCGAGACTCCGTCTCFlanking genome sequence
(185450 - 185499) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAATTAGAGCTATTGTGTCTTTATTTTCTTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 f 56851576 56937024 9 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 390 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ACAATCTGGGAATAGTGAACG | |
: TTAGGAAATCAGGCACAGACG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 15 |
: GeneBridge 4 | |
: ACAATCTGGGAATAGTGAACG | |
: TTAGGAAATCAGGCACAGACG | |
: 194 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |