HUGE |
Gene/Protein Characteristic Table for KIAA1390 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00226 |
---|---|
Accession No. : | AB037811 |
Description : | Family with sequence similarity 63, member A. |
HUGO Gene Name : | |
Clone Name : | hh08938 [Vector Info] |
Flexi ORF Clone : | pF1KA1390
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5222 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3659 bp Genome contig ID gi89161185r_149132310 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TTATGAGAGATTTTTAAATAAAAACTTTTAATTGTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAATTCCTGTGTTTTTTTTTTTCTGTGCACCAGTGTTGTCATCAATTCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 149232310 149241870 10 99.1 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 505 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GATAGGGTTCAAGGTTGTGTG | |
: AGCAATGTTTCAGCCTAAGGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: GATAGGGTTCAAGGTTGTGTG | |
: AGCAATGTTTCAGCCTAAGGG | |
: 116 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |