HUGE |
Gene/Protein Characteristic Table for KIAA1180 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01154 |
---|---|
Accession No. : | AB033006 |
Description : | Protein NDRG4. |
HUGO Gene Name : | NDRG family member 4 (NDRG4) |
Clone Name : | hf00665as1 [Vector Info] |
Flexi ORF Clone : | pF1KA1180 |
Source : | Human adult brain |
Note : | We replaced hf00665a, former representative clones for KIAA1180 with hf00665as1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2994 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1843 bp Genome contig ID gi51511732f_56991562 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
AACTGTGCTGAAAAACTAATAAAGAACCTAAGAAGFlanking genome sequence
(113258 - 113307) ----+----*----+----*----+----*----+----*----+----*
AATTCCAGTGTGGTGATGCCATGCCCATCATGGGAGGCTTTTGGAGAAAC
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 f 57091562 57104818 15 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 360 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GGACGCATCACTAAGGAAGAG | |
: AAGCATACAACGCAGTCCTGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 16 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |