HUGE

Gene/Protein Characteristic Table for KIAA1183

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05640
Accession No. :	AB033009
Description :
HUGO Gene Name :	PNMA-like 2 (PNMAL2)
Clone Name :	hg01641a [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 2752 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1714 bp

Genome contig ID gi42406306r_51586941
PolyA signal sequence
(AGTAAA,-23)
+----*----+----*----+----*----+----
CCTGGATCCTCCAGTAAAGTGAAATTCAGCACTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTCTCTCTGTGCTCTGGGCAGTGGGGCAGGCGGGGTGTGGGAGCGTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 51686941 51689686 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 345 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9ULN7	1.2e-106	100.0	PNMA-like prote...	Homo sapiens
AAI66688	5.4e-105	99.1	PNMA-like 2 [sy...	synthetic construct
XP_001167965	1.7e-104	98.8	hypothetical pr...	Pan troglodytes
XP_001111896	2.2e-101	96.8	similar to para...	Macaca mulatta
EAW57424	3.7e-86	99.0	hCG1640304 [Hom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCACCTTCATTCATGCCTTCT

Primer_r
: GTCTCAGTCAGCTTCTACATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1714 bp
Genome contig ID	gi42406306r_51586941
PolyA signal sequence (AGTAAA,-23)	+--------+--------+----*----+---- CCTGGATCCTCCAGTAAAGTGAAATTCAGCACTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTCTCTCTGTGCTCTGGGCAGTGGGGCAGGCGGGGTGTGGGAGCGTGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	51686941	51689686	1	99.0	Perfect prediction

Primer_f	: CCACCTTCATTCATGCCTTCT
Primer_r	: GTCTCAGTCAGCTTCTACATC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1183

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information