HUGE

Gene/Protein Characteristic Table for KIAA1185

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05878
Accession No. :	AB033011
Description :	Leucine-rich repeat-containing protein 47.
HUGO Gene Name :	leucine rich repeat containing 47 (LRRC47)
Clone Name :	hg02311a [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 2080 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 868 bp

Genome contig ID gi89161185r_3586644
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GATGAAAACACATAAATAAAACTACATGCACCATC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GAGGCTTGTGTAAAGACTCTGTGATCACACAGCAGCGGCTAAGCACACGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 3686644 3702360 7 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 403 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8N1G4	4.3e-149	100.0	Leucine-rich re...	Homo sapiens
XP_001915393	1.6e-125	84.7	leucine rich re...	Equus caballus
EDL81252	5.5e-124	83.9	leucine rich re...	Rattus norvegicus
NP_001129138	5.7e-124	83.9	leucine rich re...	Rattus norvegicus
XP_546742	5.7e-124	81.9	similar to Y54E...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 24 37 PR00019 Leucine-rich repeat

IPR001611 44 57 PR00019 Leucine-rich repeat

HMMPfam IPR001611 23 44 PF00560 Leucine-rich repeat

IPR005146 258 325 PF03483 B3/4

HMMSmart IPR003591 21 44 SM00369 Leucine-rich repeat

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	24	37	PR00019	Leucine-rich repeat
IPR001611	44	57	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	23	44	PF00560	Leucine-rich repeat
IPR005146	258	325	PF03483	B3/4
HMMSmart	IPR003591	21	44	SM00369	Leucine-rich repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAGTAACAAGTGCCACCAGTC

Primer_r
: TTGTGGGATCTGGAAGTTGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAGTAACAAGTGCCACCAGTC
Primer_r	: TTGTGGGATCTGGAAGTTGTC
PCR product length	: 162 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	868 bp
Genome contig ID	gi89161185r_3586644
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GATGAAAACACATAAATAAAACTACATGCACCATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GAGGCTTGTGTAAAGACTCTGTGATCACACAGCAGCGGCTAAGCACACGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	3686644	3702360	7	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA1185

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information