HUGE

Gene/Protein Characteristic Table for KIAA1196

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07484
Accession No. :	AB033022
Description :	Zinc finger protein 512B.
HUGO Gene Name :
Clone Name :	fg01776 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5742 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3185 bp

Genome contig ID gi51511747r_61958511
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
GACTGTATCAAATAAATGTTTATTGATTTTTTTCC
Flanking genome sequence
(99991 - 99942)
----+----*----+----*----+----*----+----*----+----*
AGGGTTTTTGTGCGGCTCAGTTTGTGGTGAAAAACAGGGGGCGGGGCCCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 62058502 62069319 15 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 851 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96KM6	100.0	Zinc finger pro...	Homo sapiens
EAW75182	99.3	hCG2040175, iso...	Homo sapiens
XP_525391	99.5	similar to RP4-...	Pan troglodytes
XP_001113501	97.4	hypothetical pr...	Macaca mulatta
XP_001915499	88.5	similar to Zinc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058708	9.7e-31	41.5	KIAA1805

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR004829 130 185 PD153432 Cell surface antigen

HMMPfam IPR007087 99 122 PF00096 Zinc finger

IPR007087 499 522 PF00096 Zinc finger

IPR007087 589 612 PF00096 Zinc finger

IPR007087 743 766 PF00096 Zinc finger

HMMSmart IPR015880 64 86 SM00355 Zinc finger

IPR015880 99 122 SM00355 Zinc finger

IPR015880 499 522 SM00355 Zinc finger

IPR015880 553 575 SM00355 Zinc finger

IPR015880 589 612 SM00355 Zinc finger

IPR015880 743 766 SM00355 Zinc finger

ProfileScan IPR007087 99 126 PS50157 Zinc finger

IPR007087 499 527 PS50157 Zinc finger

IPR007087 589 617 PS50157 Zinc finger

IPR007087 743 767 PS50157 Zinc finger

ScanRegExp IPR007087 101 122 PS00028 Zinc finger

IPR007087 501 522 PS00028 Zinc finger

IPR007087 591 612 PS00028 Zinc finger

IPR007087 745 766 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR004829	130	185	PD153432	Cell surface antigen
HMMPfam	IPR007087	99	122	PF00096	Zinc finger
IPR007087	499	522	PF00096	Zinc finger
IPR007087	589	612	PF00096	Zinc finger
IPR007087	743	766	PF00096	Zinc finger
HMMSmart	IPR015880	64	86	SM00355	Zinc finger
IPR015880	99	122	SM00355	Zinc finger
IPR015880	499	522	SM00355	Zinc finger
IPR015880	553	575	SM00355	Zinc finger
IPR015880	589	612	SM00355	Zinc finger
IPR015880	743	766	SM00355	Zinc finger
ProfileScan	IPR007087	99	126	PS50157	Zinc finger
IPR007087	499	527	PS50157	Zinc finger
IPR007087	589	617	PS50157	Zinc finger
IPR007087	743	767	PS50157	Zinc finger
ScanRegExp	IPR007087	101	122	PS00028	Zinc finger
IPR007087	501	522	PS00028	Zinc finger
IPR007087	591	612	PS00028	Zinc finger
IPR007087	745	766	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGTGAGAGGGACCAGCATAGC

Primer_r
: AGTGCATCCCATTTTCGTGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGTGAGAGGGACCAGCATAGC
Primer_r	: AGTGCATCCCATTTTCGTGTG
PCR product length	: 184 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3185 bp
Genome contig ID	gi51511747r_61958511
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GACTGTATCAAATAAATGTTTATTGATTTTTTTCC
Flanking genome sequence (99991 - 99942)	----+--------+--------+--------+--------+----* AGGGTTTTTGTGCGGCTCAGTTTGTGGTGAAAAACAGGGGGCGGGGCCCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	62058502	62069319	15	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1196

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information