| HUGE |
Gene/Protein Characteristic Table for KIAA1805 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK07483 |
|---|---|
| Accession No. : | AB058708 |
| Description : | Zinc finger protein 512. |
| HUGO Gene Name : | zinc finger protein 512 (ZNF512) |
| Clone Name : | fk00014 [Vector Info] |
| Flexi ORF Clone : | pF1KA1805
|
| Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3237 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1630 bp Genome contig ID gi89161199f_27574446 PolyA signal sequence
(AATAAA,-16)
GTTTGGCAATGACAAAAGAAATAAATGACTCTCAGFlanking genome sequence
(125018 - 125067)
AAAGATGTTTCCAGTGTTCTTTGACGCCGACCTGCTGCATGACTCCTTGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 27674446 27699462 12 100.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 534 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : GATTCTCTTCCCCATTTTGCG | |
| : AATTCAGGTTTCAGTGCTCCC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 2 |
| : unigene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
