HUGE

Gene/Protein Characteristic Table for KIAA1202

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00765
Accession No. :	AB033028
Description :	Protein Shroom4.
HUGO Gene Name :	shroom family member 4 (SHROOM4)
Clone Name :	fg03353 [Vector Info]
Flexi ORF Clone :	pF1KSDA1202
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 6014 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1491 bp

Genome contig ID gi89161218r_50251844
PolyA signal sequence
(AAGAAA,-29)
+----*----+----*----+----*----+----
GAAAGAAAGAAAACAGTTCCATTTACAATAGCATC
Flanking genome sequence
(99543 - 99494)
----+----*----+----*----+----*----+----*----+----*
AAAAAGAAAAAAGTACTTAGGAATAATTTAACAAAAGAAGTGCGAAACTT

Features of the protein sequence	Description

Length: 1502 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULL8	100.0	Protein Shroom4...	Homo sapiens
NP_065768	99.6	shroom family m...	Homo sapiens
XP_855411	84.4	similar to shro...	Canis lupus fam...
XP_001083331	83.7	similar to shro...	Macaca mulatta
XP_228786	77.9	similar to shro...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040914	6.7e-17	25.5	KIAA1481
AB075840	1.3e-05	30.4	KIAA1960

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001478 16 93 PF00595 PDZ/DHR/GLGF

IPR014800 774 786 PF08688 Apx/shroom

IPR014799 1204 1495 PF08687 Apx/shroom

HMMSmart IPR001478 23 96 SM00228 PDZ/DHR/GLGF

ProfileScan IPR001478 14 96 PS50106 PDZ/DHR/GLGF

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	16	93	PF00595	PDZ/DHR/GLGF
IPR014800	774	786	PF08688	Apx/shroom
IPR014799	1204	1495	PF08687	Apx/shroom
HMMSmart	IPR001478	23	96	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	14	96	PS50106	PDZ/DHR/GLGF

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCTACCCTTACCTTTCCCAGC

Primer_r
: TGAAACAAGAGGTGGTAGGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCTACCCTTACCTTTCCCAGC
Primer_r	: TGAAACAAGAGGTGGTAGGAC
PCR product length	: 112 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1491 bp
Genome contig ID	gi89161218r_50251844
PolyA signal sequence (AAGAAA,-29)	+--------+--------+----*----+---- GAAAGAAAGAAAACAGTTCCATTTACAATAGCATC
Flanking genome sequence (99543 - 99494)	----+--------+--------+--------+--------+----* AAAAAGAAAAAAGTACTTAGGAATAATTTAACAAAAGAAGTGCGAAACTT

Gene/Protein Characteristic Table for KIAA1202

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information