HUGE

Gene/Protein Characteristic Table for KIAA1212

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04462
Accession No. :	AB033038
Description :	Girdin.
HUGO Gene Name :
Clone Name :	fh00638s1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fh00638, former representative clones for KIAA1212 with fh00638s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5515 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3104 bp

Genome contig ID gi89161199r_55268730
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
ACTTATAACTGTTATTAAATACCAAATCAAATAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATAAAAGCTGTAACATTTCCTTTAAAACTAATGCTAATAAGGGATTTAGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 55368730 55403184 15 99.4 Terminal No-hit

Features of the protein sequence	Description

Length: 802 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAF44475	99.6	PKB/Akt-binding...	Homo sapiens
CAD98038	99.5	hypothetical pr...	Homo sapiens
CAI46020	99.2	hypothetical pr...	Homo sapiens
XP_852258	95.6	similar to Hook...	Canis lupus fam...
XP_001917582	95.5	coiled-coil dom...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040942	1.2e-38	37.6	KIAA1509

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTTATGCAACTTTACCTCGTG

Primer_r
: TTAGATGCTGCAGTGGTGTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTTATGCAACTTTACCTCGTG
Primer_r	: TTAGATGCTGCAGTGGTGTTG
PCR product length	: 160 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3104 bp
Genome contig ID	gi89161199r_55268730
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- ACTTATAACTGTTATTAAATACCAAATCAAATAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATAAAAGCTGTAACATTTCCTTTAAAACTAATGCTAATAAGGGATTTAGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	55368730	55403184	15	99.4	Terminal No-hit

Gene/Protein Characteristic Table for KIAA1212

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information