HUGE |
Gene/Protein Characteristic Table for KIAA1509 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK04464 |
---|---|
Accession No. : | AB040942 |
Description : | Protein Daple. |
HUGO Gene Name : | |
Clone Name : | fh14721 [Vector Info] |
Source : | Human fetal brain |
Note : | We replaced fg00804, former representative clones for KIAA1509 with fh14721. (2008/5/2) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5400 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1300 bp Genome contig ID gi51511730r_90707422 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
CAAGGACAGGACTGTAATAAAATGGAATGGAACCGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAGTGCGTTCTGGCTTTCCTCACTGCACATTGTTAGCATCGGGTGGGCCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 14 r 90807422 90849795 16 99.4 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 1365 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
RH mapping information |
Description | |
---|---|---|
: 14 |
: GeneBridge 4 | |
: ACCTGCCTTCCTAGATTTCCC | |
: CAGGTTACACATCGAGCTTGC | |
: 171 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |