HUGE

Gene/Protein Characteristic Table for KIAA1509

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK04464
Accession No. :	AB040942
Description :	Protein Daple.
HUGO Gene Name :
Clone Name :	fh14721 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fg00804, former representative clones for KIAA1509 with fh14721. (2008/5/2)

Features of the cloned DNA sequence	Description

Length: 5400 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1300 bp

Genome contig ID gi51511730r_90707422
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CAAGGACAGGACTGTAATAAAATGGAATGGAACCG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGTGCGTTCTGGCTTTCCTCACTGCACATTGTTAGCATCGGGTGGGCCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 90807422 90849795 16 99.4 Terminal No-hit

Features of the protein sequence	Description

Length: 1365 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P219	100.0	Protein Daple; ...	Homo sapiens
NP_001073883	99.9	DVL-binding pro...	Homo sapiens
XP_510123	99.5	similar to DVL-...	Pan troglodytes
XP_001144232	99.5	similar to DVL-...	Pan troglodytes
XP_001916920	85.0	similar to Prot...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033038	5.1e-28	37.6	KIAA1212

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACCTGCCTTCCTAGATTTCCC
Primer_r	: CAGGTTACACATCGAGCTTGC
PCR product length	: 171 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1300 bp
Genome contig ID	gi51511730r_90707422
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CAAGGACAGGACTGTAATAAAATGGAATGGAACCG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTGCGTTCTGGCTTTCCTCACTGCACATTGTTAGCATCGGGTGGGCCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	90807422	90849795	16	99.4	Terminal No-hit

Gene/Protein Characteristic Table for KIAA1509

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information