HUGE

Gene/Protein Characteristic Table for KIAA1213

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06101
Accession No. :	AB033039
Description :	Neuron navigator 1.
HUGO Gene Name :
Clone Name :	fh01142 [Vector Info]
Source :	Human fetal brain
Note :	Please refer to "Gene/Protein Characteristic Table for KIAA1151" because the cDNA sequence of KIAA1213 is included in KIAA1151.

Features of the cloned DNA sequence	Description

Length: 5405 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 484 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI17012	9.7e-138	96.7	neuron navigato...	Homo sapiens
BAB14142	9.2e-137	96.0	unnamed protein...	Homo sapiens
CAI17011	3.2e-136	95.1	neuron navigato...	Homo sapiens
CAD32470	3.8e-136	95.1	steerin1 protei...	Homo sapiens
EAW91374	3.8e-136	95.1	neuron navigato...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032977	5.3e-80	95.1	KIAA1151
AB037840	3.1e-12	35.4	KIAA1419
AB023155	5.6e-11	36.7	KIAA0938

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAGACAGATCGGGAAAAGGAG

Primer_r
: GTTCTTGGGAGTACTTTCTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATTCCTCACTGTTTCACCCTG
Primer_r	: GGAAAGCACTGGAAGAACGAG
PCR product length	: 174 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Primer_f	: CAGACAGATCGGGAAAAGGAG
Primer_r	: GTTCTTGGGAGTACTTTCTGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1213

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information