HUGE

Gene/Protein Characteristic Table for KIAA1419

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK01690
Accession No. :	AB037840
Description :	Neuron navigator 2.
HUGO Gene Name :	neuron navigator 2 (NAV2)
Clone Name :	ff01653 [Vector Info]
Flexi ORF Clone :	pF1KA1419
Source :	Human fetal brain
Note :	We replaced hj05749 and ph01228, former representative clones for KIAA1419 with ff01653. (2002/5/10,2002/7/05)

Features of the cloned DNA sequence	Description

Length: 11000 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3339 bp

Genome contig ID gi51511727f_19591457
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
ATTCATGATTCAATAAAATTGATGCTTATTTATTC
Flanking genome sequence
(508265 - 508314)
----+----*----+----*----+----*----+----*----+----*
AGATTAGTGGTTTGGCTTGTCTGTGCTAGAGCAAGTCCTCATAGGAGTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 f 19691457 20099720 38 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 2464 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAL96480	100.0	retinoic acid i...	Homo sapiens
NP_892009	100.0	neuron navigato...	Homo sapiens
AAL96479	99.9	retinoic acid i...	Homo sapiens
NP_660093	99.8	neuron navigato...	Homo sapiens
BAC00854	99.8	helicase [Homo ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023155	1.2e-95	55.4	KIAA0938
AB032977	2.8e-46	42.5	KIAA1151
AB033039	1.1e-09	35.5	KIAA1213

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001715 118 224 PF00307 Calponin-like actin-binding

HMMSmart IPR001715 119 222 SM00033 Calponin-like actin-binding

IPR003593 2125 2279 SM00382 AAA+ ATPase

ProfileScan IPR001715 117 224 PS50021 Calponin-like actin-binding

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001715	118	224	PF00307	Calponin-like actin-binding
HMMSmart	IPR001715	119	222	SM00033	Calponin-like actin-binding
IPR003593	2125	2279	SM00382	AAA+ ATPase
ProfileScan	IPR001715	117	224	PS50021	Calponin-like actin-binding

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3339 bp
Genome contig ID	gi51511727f_19591457
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- ATTCATGATTCAATAAAATTGATGCTTATTTATTC
Flanking genome sequence (508265 - 508314)	----+--------+--------+--------+--------+----* AGATTAGTGGTTTGGCTTGTCTGTGCTAGAGCAAGTCCTCATAGGAGTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	f	19691457	20099720	38	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1419

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information