HUGE |
Gene/Protein Characteristic Table for KIAA1419 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK01690 |
---|---|
Accession No. : | AB037840 |
Description : | Neuron navigator 2. |
HUGO Gene Name : | neuron navigator 2 (NAV2) |
Clone Name : | ff01653 [Vector Info] |
Flexi ORF Clone : | pF1KA1419
![]() |
Source : | Human fetal brain |
Note : | We replaced hj05749 and ph01228, former representative clones for KIAA1419 with ff01653. (2002/5/10,2002/7/05) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 11000 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3339 bp Genome contig ID gi51511727f_19591457 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
ATTCATGATTCAATAAAATTGATGCTTATTTATTCFlanking genome sequence
(508265 - 508314) ----+----*----+----*----+----*----+----*----+----*
AGATTAGTGGTTTGGCTTGTCTGTGCTAGAGCAAGTCCTCATAGGAGTTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 f 19691457 20099720 38 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2464 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 11 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |