HUGE |
Gene/Protein Characteristic Table for KIAA1218 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00771 |
---|---|
Accession No. : | AB033044 |
Description : | Ataxin-7-like protein 4. |
HUGO Gene Name : | ataxin 7-like 1 (ATXN7L1) |
Clone Name : | fh03016 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1218
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5410 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2784 bp Genome contig ID gi89161213r_104932750 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TGAAGCATAACGCAATGCATAGACCTGTCAGCCATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAGCGACTTGGATAACTTGTATGCCTTC
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 r 105032750 105311027 12 99.4 Internal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 864 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GTGATGTCCTCTGGGTCCTTC | |
: CTCTATGGCTGGCGACAAGTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 7 |
: GeneBridge 4 | |
: GTGATGTCCTCTGGGTCCTTC | |
: CTCTATGGCTGGCGACAAGTC | |
: 116 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |