HUGE

Gene/Protein Characteristic Table for KIAA1218

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00771
Accession No. :	AB033044
Description :	Ataxin-7-like protein 4.
HUGO Gene Name :	ataxin 7-like 1 (ATXN7L1)
Clone Name :	fh03016 [Vector Info]
Flexi ORF Clone :	pF1KSDA1218
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5410 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2784 bp

Genome contig ID gi89161213r_104932750
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGAAGCATAACGCAATGCATAGACCTGTCAGCCAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAGCGACTTGGATAACTTGTATGCCTTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 105032750 105311027 12 99.4 Internal No-hit

Features of the protein sequence	Description

Length: 864 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_065776	99.9	ataxin 7-like 1...	Homo sapiens
XP_519298	99.3	ataxin 7-like 1...	Pan troglodytes
Q9ULK2	100.0	Ataxin-7-like p...	Homo sapiens
XP_001162005	99.5	ataxin 7-like 1...	Pan troglodytes
XP_001087162	97.4	hypothetical pr...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013243 273 350 PF08313 SCA7

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013243	273	350	PF08313	SCA7

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTGATGTCCTCTGGGTCCTTC

Primer_r
: CTCTATGGCTGGCGACAAGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTGATGTCCTCTGGGTCCTTC
Primer_r	: CTCTATGGCTGGCGACAAGTC
PCR product length	: 116 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2784 bp
Genome contig ID	gi89161213r_104932750
PolyA signal sequence (None)	+--------+--------+----*----+---- TGAAGCATAACGCAATGCATAGACCTGTCAGCCAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAGCGACTTGGATAACTTGTATGCCTTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	105032750	105311027	12	99.4	Internal No-hit

Gene/Protein Characteristic Table for KIAA1218

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information