HUGE

Gene/Protein Characteristic Table for KIAA1226

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK02022
Accession No. :	AB033052
Description :	Neurolysin, mitochondrial precursor.
HUGO Gene Name :	neurolysin (metallopeptidase M3 family) (NLN)
Clone Name :	fh04414s1 [Vector Info]
Flexi ORF Clone :	pF1KA1226
Source :	Human fetal brain
Note :	We replaced fh04414, former representative clones for KIAA1226 with fh04414s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6113 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3998 bp

Genome contig ID gi51511721f_64953957
PolyA signal sequence
(AATAAA,-8)
+----*----+----*----+----*----+----
GCCTGGGTGACAGAGACCCTGTCTTAAAATAAAAT
Flanking genome sequence
(204540 - 204589)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAGGAAAAGGAAAGACATACATACCCTCAGTTCTTCGAAAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 65053957 65158495 13 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 704 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAF85492	99.9	unnamed protein...	Homo sapiens
XP_001163138	99.1	neurolysin isof...	Pan troglodytes
Q5R9V6	98.3	Neurolysin, mit...	Pongo abelii
XP_001087239	98.3	similar to neur...	Macaca mulatta
XP_001163103	99.1	neurolysin isof...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001567 251 701 PF01432 Peptidase M3A and M3B

ScanRegExp IPR006025 494 503 PS00142 Peptidase M

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001567	251	701	PF01432	Peptidase M3A and M3B
ScanRegExp	IPR006025	494	503	PS00142	Peptidase M

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TAGAGAGCCATGGGAAGAGAG

Primer_r
: ATCACCAGACAGAACAGGCTA

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3998 bp
Genome contig ID	gi51511721f_64953957
PolyA signal sequence (AATAAA,-8)	+--------+--------+----*----+---- GCCTGGGTGACAGAGACCCTGTCTTAAAATAAAAT
Flanking genome sequence (204540 - 204589)	----+--------+--------+--------+--------+----* AAAAAAAAAAGGAAAAGGAAAGACATACATACCCTCAGTTCTTCGAAAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	65053957	65158495	13	99.3	Perfect prediction

Primer_f	: TAGAGAGCCATGGGAAGAGAG
Primer_r	: ATCACCAGACAGAACAGGCTA
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1226

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information